Tropical Grasslands-Forrajes Tropicales (2017) Vol. 5(3):117–128 117
Research Paper
Effect of pollination mode on progeny of Panicum coloratum var.
makarikariense: Implications for conservation and breeding
Efecto del modo de polinización sobre la progenie de Panicum coloratum
var. makarikariense : Implicaciones para conservación y fitomejoramiento
LORENA V. ARMANDO1,2, MARÍA A. TOMÁS1, ANTONIO F. GARAYALDE2,3 AND ALICIA D. CARRERA4
1 Instituto Nacional de Tecnología Agropecuaria (INTA), EEA Rafaela, Santa Fe, Argentina. www.inta.gob.ar
2 Centro de Recursos Naturales Renovables de la Zona Semiarida, CERZOS-CCT-CONICET, Bahía Blanca, Buenos Aires, Argentina. www.cerzos-conicet.gob.ar
3 Departamento de Matemática, Universidad Nacional del Sur, Bahía Blanca, Buenos Aires, Argentina.
4 Departamento de Agronomía, Universidad Nacional del Sur, Bahía Blanca, Buenos Aires, Argentina.
www.uns.edu.ar/deptos/agronomia
Abstract
Panicum coloratum var. makarikariense, a perennial grass native to Africa, is adapted to a wide range of soil and climatic conditions with potential to be used as forage in tropical and semi-arid regions around the world. Our objective was to understand how the pollination mode affects viable seed production and further survival of the progeny. We evaluated self- and open-pollinated progenies from different accessions by measuring the seed production of the parents and their germination performance, germination rate and seedling survival. Parents and progeny were also fingerprinted with Simple Sequence Repeats (SSR). Progeny produced through open-pollination resulted in significantly more filled seeds and superior seedling survival than self-pollination. These results indicate that accessions studied here rely heavily on cross-pollination, whereas the contribution of self-pollinated offspring to the population is likely to be low. SSR profiles showed that, on average, 85% of the progeny (arising from cross-pollination) possessed paternal specific markers and 100% of them were genetically different from the maternal genotype. All plants examined had 4x = 36 chromosomes.
Overall, our findings indicate that var. makarikariense is able to generate highly polymorphic progeny through segregation and recombination. This study provides reference information for the formulation of appropriate strategies for pasture germplasm management, conservation and development of breeding programs.
Keywords : Breeding systems, pollination, genetic variation, germination, polyploidy, seed production.
Resumen
Panicum coloratum var. makarikariense es una gramínea perenne nativa de África. Se adapta a un amplio rango de ambientes y posee uso potencial como forraje en distintas regiones tropicales y semiáridas del mundo. El estudio tuvo como objetivo evaluar el efecto del modo de polinización sobre la producción de semilla viable y la supervivencia de la progenie. Se evaluaron progenies de autopolinización y de polinización cruzada en diferentes accesiones midiendo la producción de semillas, germinación, tasa de germinación y supervivencia de plántulas, y se obtuvieron perfiles moleculares con Secuencias Simples Repetidas (SSR). La progenie obtenida mediante polinización cruzada mostró ___________
Correspondence: L. Armando, Instituto Nacional de Tecnología
Agropecuaria, INTA-EEA, 2300 Rafaela, Santa Fe, Argentina.
E-mail: larmando@criba.edu.ar.
Tropical Grasslands-Forrajes Tropicales (ISSN: 2346-3775)
118 L.V. Armando, M.A. Tomás, A.F. Garayalde and A.D. Carrera
significativamente mayor producción de semillas llenas y supervivencia de plántulas que la de autopolinización. Esto indica que las accesiones evaluadas dependen en gran medida de la alogamia y que la contribución de la descendencia por autofertilización a la población sería escasa. Los perfiles moleculares SSR mostraron que, en promedio, 85% de la progenie (obtenida a partir de polinización cruzada) presentó marcadores específicos paternos y 100% de ella difirió del genotipo materno. Todas las plantas examinadas presentaron 4x = 36 cromosomas. En conjunto, los resultados indican que la var. makarikariense puede generar progenie altamente polimórfica a través de la segregación y recombinación.
Este estudio provee información útil para el diseño de estrategias de conservación, manejo del germoplasma y programas de mejoramiento.
Palabras clave : Germinación, polinización, poliploidía, producción de semilla, sistema de reproducción, variación genética.
Introduction
their evolutionary potential. This information is critical
when planning and developing conservation and breeding
The amount of genetic variability within a species and,
programs.
therefore, adaptability of their progeny to the environ-
Panicum coloratum L., a perennial grass native to
ment, are mostly determined by the breeding system.
Africa, is adapted to a wide range of soil and climatic
Autogamous and asexual species produce populations
conditions, and has been used as forage in Australia,
with little evolutionary flexibility and high local
Japan, USA, Mexico and South America (Cook et al.
specialization (Stebbins 1950), whereas outcrossing
2005). This species has been classified into mainly 2
species produce more genetically diverse and ecologically
botanical varieties, var. makarikariense Gooss. and var.
variable offspring. Grasses display an extraordinary
coloratum, distinguished by morphological traits and
diversity of breeding systems including outcrossing,
environmental preferences (Bogdan 1977; Armando et al.
selfing or mixed-breeding, and a mixture of asexual and
2013). The var. makarikariense is particularly well
sexual reproduction (Quinn 1998). Many plant species
adapted to heavy clay soils that fluctuate between drought
have developed different ecological, morphological and
and waterlogged conditions, whereas var. coloratum
physiological mechanisms that reduce the degree of self-
develops well in sandy soils, is tolerant of salinity and
fertilization to promote cross-pollination (Eckert 1994),
performs well at higher latitudes or elevations, as it
most likely motivated by the increase in individual and
thrives under low temperatures, withstanding some frost
(Tischler and Ocumpaugh 2004). In Argentina, a breeding
average population fitness caused by heterosis.
program
and
research
activities involving
var.
The frequency of outcrossing is an important deter-
makarikariense were initiated by the National Institute of
minant of population genetic structure, affecting both
Agricultural Technology (INTA) in 2006, with the
genetic diversity within populations and genetic
purpose of developing new pasture cultivars adapted to
differentiation among them (Barrett and Harder 1996).
marginal (drought, waterlogging, salinity or thermal
Methods commonly employed for assessing the mode of
stress) and less productive environments where livestock
reproduction in forage grasses include cytological and
production has been displaced, with expansion of
embryological analyses of the mother plant and screening
cropping into the most productive paddocks and planting
for morphologically aberrant progeny. Molecular marker
of soybeans.
analysis, in particular, Simple Sequence Repeat (SSR) or
Panicum coloratum botanical varieties have been
microsatellite, is a tool now widely used in a variety of
described as mainly allogamous (Brown and Emery 1958;
fundamental and applied fields of biology, including the
Hutchison and Bashaw 1964), although the degree of self-
identification of selfed, outcrossed or apomictic progeny
fertilization has not been quantified and apomictic
in several grass species (Chistiakov et al. 2006; Liu and
mechanisms have been suggested (Hutchison and Bashaw
Wu 2012). SSRs are loci ubiquitously distributed within
1964). Unlike previous reports, which focused on the
genomes that show a high level of polymorphism,
female parts of flowers and embryo sac development, our
environmental independence and rapid detection pro-
main interest is the analysis of the particular effects of
tocols. The reproductive system and the ploidy level of a
different pollination systems on viable seed production
species determine the transmission of genes across
and the survival of subsequent progeny. In addition,
generations, the pattern of inheritance and gene flow, and
cytogenetic studies in var. makarikariense showed
influence the genetic structure of plant populations and
variable numbers of chromosomes: 2n = 18, 36, 45, 49
Tropical Grasslands-Forrajes Tropicales (ISSN: 2346-3775)
Pollination mode and progeny of Panicum coloratum 119
and 63 (Hutchison and Bashaw 1964; Pritchard and De
sion were placed at 0.6 m intervals in an 8 × 4 matrix plot,
Lacy 1974).
with plots 15 m apart, while the 15 IFF genotypes were
In the present work, progeny of P. coloratum var.
clonally propagated 8 times and arranged linearly in an
makarikariense derived from self- and open-pollinated
8 × 15 matrix plot at a distance of 0.6 m.
panicles were studied through the stages of seed
production, germination and progeny survival. Addi-
Seed production
tional data were obtained from SSR marker analysis,
and chromosome number was also determined. This
Seed production of 3 plants (only 2 plants for accession
study attempted to provide information regarding
DF), selected at random from each of the UCB, MR, BR,
the reproductive behavior of P. coloratum var.
ER and CM accessions and 1 clone of each of the 15 IFF
makarikariense, with utility for conservation and
genotypes (Table 1) (a total of 32 plants) of P. coloratum
breeding.
var. makarikariense, was measured in the field from
March to May 2009. Unfortunately, 1 plant of the DF
Materials and Methods
accession was damaged and data were unavailable. For
each plant, 2 panicles were selected at random: 1 for self-
Plant samples
pollination and 1 for open-pollination. Only a single
panicle was enclosed in each seed trap, the ones for self-
Panicum coloratum was introduced into Argentina in the
pollination before anthesis and the ones for outcrossing
1990s but has not been used widely as forage, although it
when 2/3 of the panicle was in anthesis. Seed traps were
has been conserved at various locations as collections or
used in order to facilitate seed collection and to prevent
in small paddocks. Details of introductions are often
losses by seed shattering. Traps were therefore put in
limited, with many coming from different parts of the
place at different stages of development for self- and
world. A collection of P. coloratum var. makarikariense
open-pollinated treatments, but within the same treat-
(Table 1) was established in a common garden at the
ment attempts were made to select panicles at the same
INTA Rafaela Experiment Station (31°11'41'' S,
stage of development. In self-pollinated treatments seed
61°29'55'' W) in Argentina in 2006, as a breeding popu-
traps were covered with a white cotton bag to prevent
lation. Pre-breeding studies demonstrated a high level of
pollen arrival from other sources without precluding light
variability in morphological and molecular markers, both
interception and photosynthesis of glumes (Figure 1).
among and within accessions, which justified the
Self- and open-pollinated seeds were collected simulta-
initiation of a breeding program (Armando et al. 2013). In
neously once a week and manually separated from the
fact, a cultivar from the program was released recently:
glumes and other residuals. Eventually, the total number
Kapivera INTA (Giordano et al. 2013). The collection
of seeds per inflorescence was counted, i.e. dark brown
comprised 6 accessions of 32 plants each and 15 clonally
seeds (comprising lemma and palea containing a
propagated genotypes (IFF) obtained by selection on
caryopsis). Small light-weight whitish seeds (hereafter
agronomic characteristics. The 32 plants of each acces-
referred to as “empty seeds”) were also produced and
Table 1. Accessions of P. coloratum var. makarikariense and their collection site description.
Accession code
Description
Site of preservation
Coordinates
Province
DF
Twelve-year-old pasture
Dean Funes (150 km Northwest
30°26' S, 64°21' W
Córdoba
Under heavy cattle grazing
from Córdoba city)
UCB
Ungrazed pasture
Catholic University of Córdoba;
31°25' S, 64°11' W
Córdoba
collected in South Africa
MR
Ungrazed pasture
Catholic University of Córdoba;
31°25' S, 64°11' W
Córdoba
collected in South Africa
BR
Ten-year-old pasture under cattle
Mercedes Experiment Station
29°11′ S, 58°02′ W
Corrientes
grazing
(INTA); introduced from Brazil
ER
Five-year-old pasture under cattle
Private farm near Mercedes
29°03' S, 57°49' W
Corrientes
grazing
IFF 1‒15
Clonal materials
CIAP-INTA Institute of Physiology
31°24' S, 61°11' W
Córdoba
and Plant Genetic Resources
CM
Seeds commercially distributed by a cv. ‘Bambatsi’; imported from
-
private company
Australia
Tropical Grasslands-Forrajes Tropicales (ISSN: 2346-3775)
120 L.V. Armando, M.A. Tomás, A.F. Garayalde and A.D. Carrera
counted as immature florets and/or spikelets with pre-
the initiation of the germination trial. Studies by Tomás et
mature shattering from the inflorescences. Empty seeds
al. (2015) showed that maximum germination has been
show poor germination capacity, while dark brown seeds
reached by day 7. A seed was considered germinated
show a high germination percentage (Maina et al. 2017).
when the radicle emerged through the seed coat. Eight-
The final numbers of seeds produced under self- and
day-old seedlings were individually transplanted into 0.5
open-pollinated conditions were compared.
L plastic containers filled with a soil-sand-perlite mix
(1:1:1 v/v), placed in a greenhouse at 28 °C and watered
as needed, usually every 2 to 3 days. Seedling survival
percentage (% Ss) was recorded when seedlings were 15
and 40 days old.
Progeny test
In order to analyze genetic composition of the offspring,
a random sample of 12‒15 seedling descendants from 3
female parents, UCB3, ER1 and IFF10, was genetically
characterized. These plants were selected to represent
the observed range in the number of seeds produced
within var. makarikariense (see Figure 2). Progeny test
was performed only on seeds produced via open
pollination as only a limited number of progeny were
Figure 1. Seed traps enclosing inflorescences consisting of an
obtained from selfing. In addition, progeny obtained from
iron cylindrical structure covered by a nylon stocking (modified
open-pollinated traps resembled more natural pollination
from Young 1986). a) Open-pollination trap (left) and self-
conditions.
pollination trap with a white cloth bag (right). b) Detail of the
DNA extraction was carried out using a modified SDS
lower part of the trap (water drainage). Seeds (= mature florets)
method (Edwards et al. 1991). Approximately 150 mg of
were trapped and funneled into a cap as they shattered from the
leaf tissue (from plants >1 year old) was homogenized in
panicle.
liquid nitrogen. A 700 μL volume of extraction buffer
containing: 50 mM Tris pH 8, 10 mM EDTA pH 8,
Seed germination and seedling survival
100 mM NaCl, 10 mM 𝛽-mercaptoethanol and 10% SDS,
was added and incubated at 65 °C for 20 min. After
Harvested seeds were naturally air-dried and stored at
adding 200 μL of 5 M potassium acetate pH 4.8, the
room temperature in paper bags for 1 year before testing
sample was incubated on ice for at least 20 min and then
for seed germination to ensure dormancy was already
centrifuged at 13,000 rpm for 20 min. This was followed
overcome (Tischler and Young 1987). Of the 32 plants
by precipitation with 700 μL of iso-propanol incubated
evaluated, only 11 produced filled seeds under self-
at -20 °C for 10 min, and centrifugation at 13,000 rpm for
pollination. In each accession, only plants producing a
4 min. The resulting pellet was washed with ethanol 70%
good quantity of filled seeds (UCB3, MR1, BR1, ER1,
and dissolved in 100 μL of 1 x TE buffer. DNA quality
CM2, IFF10; see Figure 2) were used to evaluate
germination and seedling survival (n = 6). Thirty filled
was evaluated in agarose gel and the quantity was
seeds per panicle from the same plants in both self- and
determined by spectrophotometry.
open-pollinated treatments were placed in 10-cm
In previous work, out of 40 heterologous SSR loci
diameter Petri dishes separately with filter paper at the
evaluated in P. coloratum var. makarikariense, 10 primer
bottom moistened with distilled water, and incubated in a
pairs were successfully amplified showing polymorphic
programmed germination chamber at 42% humidity and
and clear banding patterns (Armando et al. 2015). From
27 °C (Tomás et al. 2015) at a 16-hour photoperiod (light
these, the 5 most variable ones were chosen for analysis
photon flux density: 48 mmol/s/m2). Dishes from
both of mother plants and offspring (Table 2).
different pollination treatments and different plants were
Amplification reactions were performed in 20 μL final
randomly arranged in the chamber. The number of
volume containing: 30 ng of DNA template, 2.5 mM
germinated seeds per dish was counted daily and seed
MgCl2, 0.125 mM of each dNTPs, 10 pmol of each primer
germination percentage (% G) was recorded on day 7 after
and 1 U of Taq DNA polymerase in 1.6x buffer. Negative
Tropical Grasslands-Forrajes Tropicales (ISSN: 2346-3775)
Pollination mode and progeny of Panicum coloratum 121
Table 2. Simple sequence repeat (SSR) loci used for progeny analysis and polymerase chain reactions (PCR) conditions.
Repeat motif
Source
Sequence (5´ 3´)
TD/Tm
1- (AG)8T(AG)7
EST- Panicum maximum
F: TGTATGAGCTGAGTCGC
63–53/58
R: TGGTAATCTAGTTGATATTC
2- (AG)8
EST- Panicum maximum
F: CCCGAGGCGATCCGATTCGTT
63–53/58
R: TACGCCGACGACGAGGACGA
3- (AT)13
EST- Panicum virgatum
F: TCCAGATGACTCCCAGGAAC
50–40/45
R: TCATCACTCGATTCCTCAAGC
4- (GT)38
Genomic- Panicum virgatum
F: GCAACCATGACAAGAAGCAT
63–53/58
R: ATACAAACCGGGGTGCTAAG
5- (CGT)n
EST- Eragrostis curvula
F: TCTCCAACACGCCACGAC
63–53/58
R: CAATCCACTACAAGAAACCAC
SSR 1 and 2 (Ebina et al. 2007); 3 (Tobias et al. 2006); 4 (Wang et al. 2011); 5 (Cervigni et al. 2008).
TD/Tm: Touchdown/Annealing temperature; F: forward primer; R: reverse primer.
controls (no DNA template) were also included. Poly-
removed from the roots, placed in a drop of 2% hema-
merase chain reactions (PCR) were carried out in an MJ
toxylin with 2% ferric citrate used as mordant, and
Research Thermal Cycler. The optimum annealing
squashed (modified from Núñez 1968). Cells with fully
temperature (Tm) was determined for each locus (Table
contracted and well spread metaphase chromosomes were
2). By touchdown PCR (TD), the annealing temperature
photographed using a digital camera.
was decreased to 1 °C starting with 5 °C over the set
annealing temperature. Initial denaturation step of 95 °C
Data analyses
for 3 min was followed by 10 touchdown cycles of 94 °C
for 30 sec, touchdown annealing temperature for 30 sec
Average number of filled and empty seeds, germination
and 72 °C for 45 sec. PCR products were subsequently
percentages at day 7, time at which 50% of seeds had
amplified for 34 cycles at 94 °C for 30 sec, annealing
germinated (T50) and survival of 15- and 40-day-old
temperature for 30 sec, and 72 °C for 45 sec with a final
seedlings were recorded for self- and open-pollinated
extension at 72 °C for 20 min. Amplifications were
conditions. The mean values obtained for the 2 forms of
initially checked on 1% agarose gels. PCR products were
pollination were compared through one-tailed Student’s t-
analyzed on 6% denaturing polyacrylamide gel, with a
test for paired samples, since a higher number of filled
TBE 1x electrophoresis buffer at 50W for 1 h and 45 min
seeds was expected in cross-pollination. Analysis of
to 2 h. Bands were visualized by silver staining and
variance (ANOVA) for the mean number of seeds was
scanned.
performed and accessions were compared by Fisher’s
LSD tests. Statistical analyses were performed using
Chromosome number
Infostat software (Di Rienzo et al. 2008).
Based on the number of seeds, germination and
To confirm the chromosome number of P. coloratum var.
survival data per panicle, probability of seed production,
makarikariense, 8 different plants were evaluated. One plant
and probability of seedling survival for self- or cross-
from each accession was chosen at random and considered
pollinated conditions were estimated by using the
representative of each accession (DF, UCB, MR, BR, ER
and CM), while 2 plants were selected from IFF.
conditional probability and Bayes Theorem (Quinn and
Root tips of 3-month-old plants were pretreated with
Keough 2002). The probability of seedling survival (SS)
8-hydroxyquinoline (0.002 ml/g) for 5 h. The roots were
was calculated as: P(SS) = P(SS/SPs)*P(SPs) +
fixed in a freshly prepared mixture of ethanol:glacial
P(SS/SPo)*P(SPo), where P(SS/SPS) and P(SS/SPO) are
acetic acid (3:1 v/v) for 48 h at room temperature and then
the conditional probabilities of seedling survival from
placed in 70% ethanol at 4 °C for several weeks. Treated
seeds produced under self- and open-pollinated condi-
roots were put in 95, 70 and 40% ethanol and distilled
tions, respectively; P(SPs) and P(SPo) are the probabil-
water for 15 min each, hydrolyzed in 1 N HC1 at 60 °C
ities of seed production under self- and open-pollination;
for 8 min, transferred to distilled water for 2 min and
and P(SS) is the probability of seedling survival. The
stained in leuco-basic fuchsin for 1 h at room temperature
conditional probability of finding a plant given that it was
in the dark. The 3–4 mm deeply stained root tips were
produced under self- or open-pollination was calculated
Tropical Grasslands-Forrajes Tropicales (ISSN: 2346-3775)
122 L.V. Armando, M.A. Tomás, A.F. Garayalde and A.D. Carrera
as: P(SPs/SS) = P(SS/SPs)*P(SPs)/P(SS) and P(SPo/SS)
per panicle was highly variable among plants, registering
= P(SS/SPo)*P(SPo)/P(SS), respectively.
values from 0 to 72 (CV = 149%) for self-pollinated
In the progeny test, offspring’s DNA fingerprints were
panicles and from 14 to 795 (CV = 61%) for open-
individually compared with the maternal pattern. The
pollinated panicles (Figure 2). Mean number of filled
occurrence of a sexual reproduction event was defined as
seeds differed significantly among accessions for both
when progeny DNA fingerprints revealed a deviation
self- and open-pollination methods (Figure 3). According
from the maternal profile. Each band was considered as
to Fisherś LSD test, the commercial variety (cv.
an independent locus, and polymorphic bands were
Bambatsi) had the highest mean number of filled seeds
scored visually as either absent (0) or present (1) for each
under open-pollination, while the lowest number was
of the 45 plants. Only those bands consistently scored
from accession BR (Figure 3).
were considered for analysis. By combining the markers,
Regarding progeny performance, the seed germination
unique profiles were obtained for each individual. Genetic
percentages were above 80% and together with T50 no
diversity in the progeny was estimated using the total
significant differences were observed in filled seeds
number of alleles, number of alleles shared with female
obtained from both self- and open-pollinated conditions
parents (maternal alleles) or deriving from male parents
(Table 3). In all the plants evaluated T50 values showed
(paternal alleles), and percentage of polymorphic loci
that at least half of the seeds (range 50–97%) had
(%P).
germinated by the 3rd day after the trial started, except for
The genetic dissimilarity between the maternal parents
one plant where T50 extended to the 5th day (data not
and their progeny was analyzed using a genetic binary
shown). The survival of both self- and open-pollinated
distance (GD) according to Huff et al. (1993). An
seedlings decreased over time, but the survival of seedlings
UPGMA cluster was obtained from GD matrix. Analyses
derived from open-pollination was significantly higher
of molecular data were performed using GenAlEx 6,
(P<0.001) than those obtained from selfing at both 15 and
Genetic Analysis in Excel (Peakall and Smouse 2012) and
40 days of age. In particular, survival of 40-day-old
Infostat programs (Di Rienzo et al. 2008).
seedlings from self-pollinated panicles was much lower
than that from out-crossing (4.8 vs. 35.7%) (Table 3).
Results
Estimates of total seed production and seedling survival
of plants from accessions of var. makarikariense are shown
Effect of pollination method on progeny number and
in Table 4, differentiating those obtained from the different
seedling survival
methods of pollination. Of the total number of filled seeds
produced per panicle, the probability of them being
The mean number of filled seeds per panicle under open-
produced by open-pollination was greater (92%) than by
pollination was considerably higher than those produced
self-pollination (8%). The estimated survival at 40 days of
under self-pollination (P<0.001, Table 3). In contrast, the
a seedling from a seed obtained by self-pollination was
mean number of empty seeds (empty perfect florets
lower (6%) than the survival of a seedling coming from a
and/or caryopses unable to germinate) did not differ
seed obtained by open-pollination (32%). In addition, the
significantly between the 2 forms of pollination (P =
estimated probability of plant survival for this period of
0.1518, Table 3). In general, the number of filled seeds
time, independently of whether it came from self- or open-
Table 3. Comparison of the average number of filled (n° Fs) and empty (n° Es) seeds per panicle, seed germination percentage (% G), time needed for seeds to reach 50% germination (T50) and seedling survival percentage (% SS) of 15- and 40-day-old seedlings, between self-pollinated and open-pollinated panicles, using the student t-test in P. coloratum var. makarikariense.
n° Fs
n° Es
% G
T50
% SS 15
% SS 40
n
32
32
6
6
6
6
Mean Self
10.9
176.1
88.5
80.1
38.1
4.78
Mean Open
279.2
207.6
81.7
85.6
77.6
35.73
Mean difference
-268.3
-31.5
6.83
-5.48
-39. 5
-31.0
T
-9.13
-1.05
0.91
-1.94
-10.15
-5.80
P
<0.0001
0.1518
0.7980
0.0551
0.0001
0.0011
n: number of genotypes evaluated.
T: Student t-values. P: p value of student t-test.
Tropical Grasslands-Forrajes Tropicales (ISSN: 2346-3775)
Pollination mode and progeny of Panicum coloratum 123
Figure 2. Number of filled seeds produced per panicle under self-pollination and open-pollination in 32 individuals of P. coloratum var. makarikariense.
Figure 3. Mean number of filled seeds produced per panicle under self-pollination and open-pollination in accessions of P. coloratum var. makarikariense. In each type of pollination, different letters indicate significant differences between accessions (P<0.001) using Fisher’s LSD tests and bars represent standard errors of means (lower case letters refer to open-pollinated and upper case to self-pollinated).
Table 4. Probabilities of seed production (SP) under self- (S) or open-pollination (O) and seedling survival (SS) in P. coloratum var.
makarikariense.
Pollination
Probabilities
UCB
MR
BR
ER
CM
IFF
Mean
Self
p(SPS)
0.29
0.09
0.09
0.11
0.03
0.05
0.08
p(SS/SPS)
0.13
0.00
0.00
0.03
0.00
0.10
0.06
p(SPS/SS)
0.15
0.00
0.00
0.01
0.00
0.02
0.03
Open
p(SPO)
0.71
0.91
0.91
0.89
0.97
0.95
0.92
p(SS/SPO)
0.30
0.23
0.36
0.53
0.17
0.37
0.32
p(SPO/SS)
0.85
1.00
1.00
0.99
1.00
0.98
0.97
-
p(SS)
0.25
0.21
0.32
0.48
0.16
0.35
0.30
p(SS/SPS) and p(SS/SPO): conditional probability of seedling survival given that seed production was under self- or open-pollination, respectively.
p(SPs/SS) and p(SPO/SS): conditional probability of finding a plant given that it was produced under self- or open-pollination, respectively.
Tropical Grasslands-Forrajes Tropicales (ISSN: 2346-3775)
124 L.V. Armando, M.A. Tomás, A.F. Garayalde and A.D. Carrera
Figure 4. Percentage of SSR alleles attributed to female ( ) and male ( ) parents in progenies of P. coloratum var. makarikariense from 3 accessions (names are detailed in Table 1).
pollination, was 30%. Combining data, the estimated prob-
maternal and paternal alleles could be recognized in
ability of finding a plant obtained by open-pollination was
individual progeny (Table 5). On average, 85% (range
significantly higher (97%) than those produced by self-
67–100%) of individual progeny presented alleles not
pollination (3%).
found in the female parent (Figure 4). Additionally,
offspring were not identical with their maternal patterns
Effects of pollination method on genetic variability and
but they were closely grouped in the dendrogram
contrast with female parents
according to families (Figure 5). Moreover, the 3 female
plants were genetically distinct.
Progeny from 3 female parents were analyzed with 5 SSR
markers. Offspring plants were classified as identical
Chromosome numbers in the P. coloratum var.
when patterns were the same as the female parents at all
makarikariense collection
the evaluated SSR loci or distinct when any band
differences between female parent and progeny were
In all mitotic cells observed, 36 chromosomes were
observed. The SSR analysis showed values of percent
counted at metaphase. This number remained stable for
polymorphic loci (%P) over 50% in progenies, and
all 8 P. coloratum var. makarikariense plants evaluated.
Table 5. Genetic diversity in 3 progeny of P. coloratum var. makarikariense assessed by 5 simple sequence repeat markers (SSR).
Female parent
N° progeny
Total alleles
Maternal alleles
Paternal alleles
%P
UCB3
15
22
14
8
50.0
ER1
15
23
12
11
56.3
IF10
12
25
16
9
62.5
%P: percentage of polymorphic SSR loci in progeny.
Tropical Grasslands-Forrajes Tropicales (ISSN: 2346-3775)
Pollination mode and progeny of Panicum coloratum 125
Figure 5. Unweighted pair-group method with arithmetical average (UPGMA) dendrogram based on the GD SSR matrix of 3
female parents (F) and their progeny (P) in families of P. coloratum var. makarikariense. The female plants are underlined.
Discussion
production per panicle among genotypes from different
accessions in the collection (Barrios et al. 2010). These
There is an increasing need for a better understanding of
accessions are also distinctive in other morphological
the reproductive biology in P. coloratum, given that this
characters, both vegetative and reproductive (Giordano et
is an extremely important prerequisite to develop breed-
al. 2013; Armando et al. 2013; 2015). In addition, seed
ing strategies and also for germplasm management and
yield is a complex character and additional variability
conservation purposes. In this study, we sought to
arises as seed set is the culmination of a series of process-
determine the preponderant mode of reproduction of one
es at canopy level including radiation interception, bio-
collection of the var. makarikariense used for breeding
mass production and partitioning. Therefore, variability
purposes both by evaluating seed production in open and
among individuals may be the result of both genetic
forced-to-inbreed panicles and by a progeny test using
variation and the integration of these different genetic
SSR markers. The evaluated plants in this study were
backgrounds with the multiple environmental influences
selected to cover the variability present in the germplasm
(Boelt and Studer 2010). The considerable differences in
collection at INTA EEA Rafaela, which comprises
seed production we observed among plants and
accessions collected within semi-arid temperate mesic
accessions suggest a promising scenario for selection to
and subtropical zones, both grazed and non-grazed areas,
increase seed production by means of augmenting the
and a commercial variety. Although we analyzed only 3
number of seeds per panicle.
panicles per accession, our results corroborate previously
The results from seed production, germination and
reported studies pointing out extensive variability in seed
seedling survival assessments in var. makarikariense
Tropical Grasslands-Forrajes Tropicales (ISSN: 2346-3775)
126 L.V. Armando, M.A. Tomás, A.F. Garayalde and A.D. Carrera
indicated that open-pollination is by far the most frequent
Progeny without clear paternal contribution were
form of pollination in the reproductive biology of this
probably derived from self-pollination or open-
variety. A similar behavior is suggested for var.
pollination involving parents with the same molecular
coloratum based on a small sample of 3 plants (data not
pattern, although this value may be reduced with an
shown). Additionally, as only a few panicles produced
increased number of markers. In addition, the level of
good quality seeds by self-pollination, a limited number
genomic DNA polymorphism of the analyzed progeny
of plants could be analyzed. However, the results from the
suggests sexuality and genetic recombination, and
combined probabilities clearly showed that progeny from
provides additional evidence that P. coloratum is mainly
selfing make low to no contribution to the population over
an allogamous species.
time since a mean of only 6% of the plants obtained from
All our analyses accumulated evidence pointing to
self-pollinated seeds survived. Although seeds obtained
P. coloratum var. makarikariense as a species with
under self-pollination were not weighed, they were
mainly sexual reproduction that depends primarily on
visibly much smaller than and had a different color (white
open-pollination to obtain viable offspring. All var.
vs. brown) from those produced by open-pollination,
makarikariense plants evaluated in this study had 36
which could explain the lower vigor of the seedlings
chromosomes, and the same number was observed in 3
(Tomás et al. 2007). The fact that we did obtain seeds
plants of var. coloratum (data not shown). Considering a
from selfing demonstrates the existence of some degree
basic number of x = 9 (Hamoud et al. 1994), these plants
of self-compatibility. Burson and Young (1983), using
are tetraploids. This ploidy level is one of the most
fluorescence microscopy, demonstrated that, when var.
frequently reported for P. coloratum (Hutchison and
coloratum was self-pollinated, 90% of the pollen germi-
Bashaw 1964; Pritchard and De Lacy 1974). Apomixis
nated within minutes after the pollen grain came in
occurs throughout the plant kingdom and is always
contact with the stigma, but only 2% of the pollen tubes
associated with polyploidy as was reported in Panicum
actually grew into the ovary and entered the micropyle
maximum and Paspalum notatum (Warmke 1954; Quarin
within 1 hour after pollination, suggesting active self-
et al. 2001). However, sexuality also occurs at the 4x and
incompatibility mechanisms. A gametophytic S-Z in-
6x ploidy levels as in Panicum virgatum and Brachiaria
compatibility system has been found in related species
humidicola (Barnett and Carver 1967; Pagliarini et al.
(Martinez-Reyna and Vogel 2002) and is common for
2012). The natural distribution of diploid and tetraploid
most of Poaceae (Baumann et al. 2000). In the majority of
levels in P. coloratum at its center of origin appears to
the grasses this system is not absolute, and some seeds
occur throughout central and South Africa, while the
may be obtained from self-fertilization. Further, selfed
hexaploid level was confined to East Africa (Pritchard
progeny of highly heterozygous genotypes could result in
and De Lacy 1974).
fitness reduction due to inbreeding (Eckert 1994), a point
Knowledge of the chromosome number and ploidy
that we cannot prove with only one generation of selfing.
level of the germplasm is necessary for developing an
Brown and Emery (1958) observed typical sexual 8-
efficient strategy of preservation of this promising forage
nucleate embryo sacs in 82 ovules of var. makarikariense
species and is crucial for use in the P. coloratum breeding
and var. coloratum plants indicating both varieties
program. The ploidy level of this species may partially
reproduced sexually . Hutchison and Bashaw (1964) also
explain the high level of genetic variability in the species
observed 8-nucleate embryo sacs in both varieties but
and the highly polymorphic progeny. New genetic
about 2% of the older ovules had large vacuolated cells,
combinations seem to be obtained relatively easily
which appeared similar to multiple embryo sacs. They
through segregation and recombination. This fact may
considered this as possible evidence of apospory, but
represent an interesting means to increase germplasm
developed embryos were not observed in these cells,
variability and may be an important factor to consider
which dispelled the possibility of apomixis in this species.
when releasing new materials resulting from selection and
The high amount of variation expressed in open-
breeding. In addition, the mode of reproduction in a given
pollinated makarikariense progeny rules out the
species must be clear to the plant breeder to accomplish
possibility of apomictic reproduction in the species. In our
crop improvement. Knowledge about how a plant
study, molecular progeny tests revealed that an average of
reproduces naturally helps the breeder to predict the
85% of offspring possessed paternal alleles; this is
behavior under field conditions and to establish the most
indicative of cross-pollination and 100% of them were
appropriate selection method, which markedly differs
genetically distinguishable from the maternal genotype.
between self- and cross-pollinated crops. Knowledge of
Tropical Grasslands-Forrajes Tropicales (ISSN: 2346-3775)
Pollination mode and progeny of Panicum coloratum 127
breeding systems is also of benefit for germplasm banks.
Bogdan AV. 1977. Tropical pasture and fodder plants (grasses
Based on our results, the number of individuals destined
and legumes). Tropical Agriculture Series, Longman Group,
for seed increase should be large enough to include the
London, UK.
Brown WV; Emery WHP. 1958. Apomixis in the Gramineae:
original variability in genetic diversity. Moreover,
Panicoideae. American Journal of Botany 45:253–263.
isolation distances need to be taken into account in order
to prevent gene flow among accessions and thus preserve
Burson BL; Young BA. 1983. Pollen-pistil interactions and
the genetic identity of each accession.
interspecific-incompatibility among Panicum antidotale, P.
coloratum, and P. deustum. Euphytica 32:397–405. DOI:
Acknowledgments
Cervigni G; Paniego N; Diaz M; Selva JP; Zappacosta D;
Zanazzi D; Landerreche I; Martelotto, L; Felitti S; Pessino
A fellowship for L.V. Armando from the National
S; Spangenberg G; Echenique V. 2008. Expressed sequence
Research Council of Argentina (CONICET) is
tag analysis and development of gene associated markers in
acknowledged. The authors thank M. Pisani, B. Tolozano,
a near-isogenic plant system of Eragrostis curvula. Plant
C. Barrios, M. Giordano, N. Dreher and M. Maina for
Molecular Biology 67:1–10. DOI: 10.1007/s11103-007-
their help in the field assay. We also thank M. Poverene,
S. Ureta and M. Sartor for their contribution in the
Chistiakov DA; Hellemans B; Volckaert FAM. 2006.
cytogenetic study. Financial support was provided by
Microsatellites and their genomic distribution, evolution,
National Institute of Agricultural Technology (INTA
function and applications: A review with special reference
Rafaela) PNPA 1126072 and the Agencia Nacional de
to fish genetics. Aquaculture 255:1–29. DOI 10.1016/
Promoción Científica y Tecnológica (ANPCyT, PICT
Cook BG; Pengelly BC; Brown SD; Donnelly JL; Eagles DA;
2011-2188). We are grateful to Drs. Byron Burson and
Franco MA; Hanson J; Mullen BF; Partridge IJ; Peters M;
Russell Jessup for their helpful comments on a very early
Schultze-Kraft R. 2005. Tropical Forages: An interactive
version of the manuscript.
selection tool. CSIRO, DPI&F (Qld), CIAT and ILRI,
Brisbane, Australia. www.tropicalforages.info/
References
Di Rienzo JA; Casanoves F; Balzarini MG; Gonzalez L;
Tablada M; Robledo CW. 2008. InfoStat, Versión 2008,
Armando LV; Carrera AD; Tomás MA. 2013. Collection and
Grupo InfoStat, FCA, Universidad Nacional de Córdoba,
morphological characterization of Panicum coloratum L. in
Argentina. www.infostat.com.ar
Argentina. Genetic Resources and Crop Evolution 60:1737–
Ebina M; Kouki K; Tsuruta S; Akashi R; Yamamoto T;
1747. DOI: 10.1007/s10722-013-9982-3
Takahara M; Inafuku M; Okumura K; Nakagawa H;
Armando LV; Tomás MA; Garayalde AF; Carrera AD. 2015.
Nakajima K. 2007. Genetic relationship estimation in
Assessing the genetic diversity of Panicum coloratum var.
guineagrass ( Panicum maximum Jacq.) assessed on the basis
makarikariense using agro-morphological traits and
of simple sequence repeat markers. Grassland Science
microsatellite-based markers. Annals of Applied Biology
53:155–164. DOI: 10.1111/j.1744-697X.2007.00086.x
167:373–386. DOI: 10.1111/aab.12234
Eckert CG. 1994. Inbreeding depression and the evolutionary
Barnett FL; Carver RF. 1967. Meiosis and pollen stainability in
advantage of outbreeding. In: Goldman CA, ed. Tested
switchgrass, Panicum virgatum L. Crop Science 7:301–304.
studies for laboratory teaching. Volume 15. Proceedings of
DOI: 10.2135/cropsci1967.0011183X000700040005x
the 15th Workshop/Conference of the Association for
Biology Laboratory Education (ABLE), 8-12 June 1993,
Barrett SCH; Harder LD. 1996. Ecology and evolution of plant
University of Toronto, Canada. p. 215–238. goo.gl/WGoC8k
mating. Trends in Ecology and Evolution 11:73–79. DOI:
Edwards K; Johnstone C; Thompson C. 1991. A simple and
rapid method for the preparation of plant genomic DNA for
Barrios C; Armando L; Berone G; Tomás A. 2010. Seed yield
PCR analysis. Nucleic Acids Research 19:1349. DOI:
components and yield per plant in populations of Panicum
coloratum
L.
var.
makarikariense
Goossens.
7th
Giordano MC; Berone GD; Tomás MA. 2013. Selection by seed
International Herbage Seed Conference, Dallas, TX, USA,
weight improves traits related to seedling establishment in
11–13 April 2010. p. 152–158. https://goo.gl/UNQy6w
Panicum coloratum L. var. makarikariense. Plant Breeding
Baumann U; Juttner J; Bian X; Langridge P. 2000. Self-
132:620–624. DOI: 10.1111/pbr.12106
incompatibility in the grasses. Annals of Botany 85:203–
Hamoud MA; Haroun SA; Macleod RD; Richards AJ. 1994.
209. DOI: 10.1006/anbo.1999.1056
Boelt B; Studer B. 2010. Breeding for grass seed yield. In:
Cytological relationships of selected species of Panicum L.
Boller B; Posselt UK; Veronesi F, eds. Fodder crops and
Biologia Plantarum 36:37–45. DOI: 10.1007/BF02921265
amenity grasses. Handbook of Plant Breeding 5. Springer
Huff DR; Peakall R; Smouse PE. 1993. RAPD variation within
New York, USA. p. 161–174. DOI: 10.1007/978-1-4419-
and among natural populations of outcrossing buffalograss
[ Buchlöe dactyloides (Nutt.) Engelm.]. Theoretical and
Tropical Grasslands-Forrajes Tropicales (ISSN: 2346-3775)
128 L.V. Armando, M.A. Tomás, A.F. Garayalde and A.D. Carrera
Applied Genetics 86:927–934. DOI: 10.1007/BF00211043
analysis for biologists. Cambridge University Press, UK and
Hutchison DJ; Bashaw EC. 1964. Cytology and reproduction of
New York, USA.
Panicum coloratum and related species. Crop Science
Quinn J. 1998. Ecological aspects of sex expression in grasses.
4:151–153. DOI: 10.2135/cropsci1964.0011183x0004000
In: Cheplick GP, ed. Population biology of grasses.
Cambridge University Press, UK and New York, USA.
Liu L; Wu Y. 2012. Development of a genome-wide multiple
Stebbins GL. 1950. Variation and evolution in plants. Columbia
duplex-SSR protocol and its applications for the identi-
University Press, New York, USA.
fication of selfed progeny in switchgrass. BMC Genomics
Tischler CR; Young BA. 1987. Development and character-
13:522. DOI: 10.1186/1471-2164-13-522
istics of a kleingrass population with reduced post-harvest
Maina M; Armando LV; Tomás MA. 2017. Understanding
seed dormancy. Crop Science 27:1238–1241. DOI:
shattering process: Differences in seeds characteristics
10.2135/cropsci1987.0011183x002700060030x
shattered at different times in Panicum coloratum var.
Tischler CR; Ocumpaugh WR. 2004. Kleingrass, blue panic
makarikariense. 9th Conference of the International
and vine mesquite. In: Moser LE; Burson BL; Sollenberger
Herbage Seed Group, Pergamino, Argentina, October 2017.
LE,
eds.
Warm-season
(C4)
grasses.
Agronomy
Martinez-Reyna JM; Vogel KP. 2002. Incompatibility systems
Monograph. American Society of Agronomy, Madison, WI,
in switchgrass. Crop Science 42:1800–1805. DOI:
USA. p. 623–649. DOI: 10.2134/agronmonogr45.c18
Tobias CM; Hayden DM; Twigg P; Sarath G. 2006. Genic
Núñez O. 1968. An acetic-haematoxylin squash method for
microsatellite markers derived from EST sequences of
small chromosomes. Caryologia 21:115–119. DOI:
switchgrass ( Panicum virgatum L.). Molecular Ecology
10.1080/00087114.1968.10796290
Notes 6:185–187. DOI: 10.1111/j.1471-8286.2006.01187.x
Pagliarini MS; Valle CB do; Vieira MLC. 2012. Meiotic
Tomás A; Berone G; Pisani M; Ribotta; Biderbost E. 2007.
behavior in intra- and interspecific sexual and somatic
Relación entre peso de semillas, poder germinativo y
polyploid hybrids of some tropical species. In: Swan A, ed.
emergencia de plántulas en clones de Panicum coloratum L.
Meiosis ‒ molecular mechanisms and cytogenetic diversity.
Revista Argentina de Producción Animal 27(supl. 1):205‒
INTECH Open Access Publisher. p. 331-348. DOI:
Tomás A; Giordano M; Pisani M. 2015. Effect of increasing
Peakall R; Smouse PE. 2012. GenAlEx 6.5: Genetic analysis in
temperatures on germination of two varieties of Panicum
Excel. Population genetic software for teaching and
coloratum. 8th Conference of the International Herbage
research – an update. Bioinformatics 28:2537–2539. DOI:
Seed Group, Lanzhou, Gansu, China, 21-30 June 2015.
Wang Y; Samuels T; Wu Y. 2011. Development of 1,030
Pritchard AJ; De Lacy IH. 1974. The cytology, breeding system
genomic SSR markers in switchgrass. Theoretical and
and flowering behaviour of Panicum coloratum. Australian
Applied Genetics 122:677–686. DOI: 10.1007/s00122-010-
Journal of Botany 22:57–66. DOI: 10.1071/BT9740057
Quarin CL; Espinoza F; Martinez EJ; Pessino SC; Bovo OA.
Warmke H. 1954. Apomixis in Panicum maximum. American
2001. A rise of ploidy level induces the expression of
Journal of Botany 41(1):5–11. DOI: 10.2307/2438575
apomixis in Paspalum notatum. Sexual Plant Reproduction
Young BA. 1986. A source of resistance to seed shattering in
13:243–249. DOI: 10.1007/s004970100070
kleingrass, Panicum coloratum L. Euphytica 35:687–694.
Quinn GP; Keough MJ. 2002. Experimental design and data
(Received for publication 30 December 2016; accepted 16 August 2017; published 30 September 2017)
© 2017
Tropical Grasslands-Forrajes Tropicales is an open-access journal published by Centro Internacional de Agricultura Tropical (CIAT). This work is licensed under the Creative Commons Attribution-NonCommercial-ShareAlike 3.0
Unported license. To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-sa/3.0/
