This issue is dedicated to the memory of Ronald (Ron) J. Williams (1930-2017), Australian
plant geographer and pasture scientist, a pioneer in tropical forage plant collection,
introduction and evaluation. His friends and colleagues throughout the tropical world will
not forget him for his remarkable personality and intimate knowledge, vision and enthusiasm
for tropical forage plant genetic resources.
International Center for Tropical Agriculture (CIAT) retains copyright of articles with the work simultaneously licensed under the Creative Commons − Attribution-NonCommercial-ShareAlike 3.0 Unported license (to view a copy of this license, visit
http://creativecommons.org/licenses/by-nc-sa/3.0/).
Accordingly, users/readers are free to share (to copy, distribute and transmit) and to remix (to adapt) the work under the conditions of Attribution, Noncommercial, and Share Alike (see http://creativecommons.org/licenses/by-nc-sa/3.0/).
Rainer Schultze-Kraft,
Lyle Winks,
Centro Internacional de Agricultura Tropical (CIAT),
Former editor of “Tropical Grasslands”,
Colombia
Australia
Management Committee
Changjun Bai,
Rainer Schultze-Kraft,
Chinese Academy of Tropical Agricultural Sciences
Centro Internacional de Agricultura Tropical (CIAT),
(CATAS),
Colombia
P.R. China
Cacilda B. do Valle,
Robert J. Clements,
Empresa Brasileira de Pesquisa Agropecuária (Embrapa),
Agricultural Consultant,
Brazil
Australia
Lyle Winks,
Asamoah Larbi,
Former editor of “Tropical Grasslands”,
International Institute of Tropical Agriculture (IITA),
Australia
Nigeria
Michael Peters,
Centro Internacional de Agricultura Tropical (CIAT),
Colombia
Editorial Board
Changjun Bai,
Albrecht Glatzle,
Chinese Academy of Tropical Agricultural Sciences
Iniciativa para la Investigación y Transferencia de
(CATAS),
Tecnología Agraria Sostenible (INTTAS),
P.R. China
Paraguay
Caterina Batello,
Orlando Guenni,
Food and Agriculture Organization of the United Nations
Universidad Central de Venezuela (UCV),
(FAO),
Venezuela
Italy
Jean Hanson,
International Livestock Research Institute (ILRI),
Michael Blümmel,
Ethiopia
International Livestock Research Institute (ILRI),
India
Michael David Hare,
Ubon Ratchathani University,
Robert J. Clements,
Agricultural Consultant,
Thailand
Australia
Mario Herrero,
Commonwealth Scientific and Industrial Research
Myles Fisher,
Organisation (CSIRO),
Centro Internacional de Agricultura Tropical (CIAT),
Australia
Colombia
Bruce Pengelly,
University of Miyazaki,
Agricultural Consultant,
Japan
Australia
Peter Horne,
T. Reginald Preston,
Australian Centre for International Agricultural Research
University of Tropical Agriculture Foundation (UTA),
(ACIAR),
Colombia
Australia
Johann Huguenin,
Kenneth Quesenberry,
Centre de Coopération Internationale en Recherche
University of Florida,
Agronomique pour le Développement (CIRAD),
USA
France
Max Shelton,
Muhammad Ibrahim,
University of Queensland,
Centro Agronómico Tropical de Investigación y Enseñanza
Australia
(CATIE),
Costa Rica
Werner Stür,
Australian Centre for International Agricultural Research
Asamoah Larbi,
(ACIAR),
International Institute of Tropical Agriculture (IITA),
Australia
Nigeria
Carlos E. Lascano,
Cacilda B. do Valle,
Universidad Nacional de Colombia - Sede Bogotá,
Empresa Brasileira de Pesquisa Agropecuária (Embrapa),
Colombia
Brazil
Robert Paterson,
Agricultural Consultant,
Spain
Principal Contacts
Rainer Schultze-Kraft
Centro Internacional de Agricultura Tropical (CIAT)
Colombia
Phone: +57 2 4450100 Ext. 3036
Email: r.schultzekraft@cgiar.org
Technical Support
José Luis Urrea Benítez
Centro Internacional de Agricultura Tropical (CIAT)
Colombia
Phone: +57 2 4450100 Ext. 3354
Email: CIAT-TGFT-Journal@cgiar.org
Research Papers
Temporal differences in plant growth and root exudation of two Brachiaria grasses in response to low
103-116
Anna E. Louw-Gaume, Noel Schweizer, Idupulapati M. Rao, Alain J. Gaume, Emmanuel Frossard
Effect of pollination mode on progeny of Panicum coloratum var. makarikariense: Implications for
117-128
Lorena V. Armando, Maria A. Tomás, Antonio F. Garayalde, Alicia D. Carrera
129-142
Swarnendu Roy, Usha Chakraborty
Reduction of sward height in the fall and winter as a strategy to improve the structure of marandu
143-152
palisadegrass ( Urochloa brizantha syn. Brachiaria brizantha cv. Marandu)
Manoel E.R. Santos, Miriã G. Simplício, Guilherme P. Silva, Heron A. Oliveira, Ludiêmilem K.P. da
Costa, Diogo O.C. de Sousa
Evaluation and strategies of tolerance to water stress in Paspalum germplasm
153-162
Cristiana de G. Pezzopane, Arthur G. Lima, Pedro G. da Cruz, Tatiane Beloni, Alessandra P. Fávero,
Patrícia M. Santos
Screening of common tropical grass and legume forages in Ethiopia for their nutrient composition and
163-175
methane production profile in vitro
Aberra Melesse, Herbert Steingass, Margit Schollenberger, Markus Rodehutscord
Tropical Grasslands-Forrajes Tropicales (2017) Vol. 5(3):103–116 103
Research Paper
Temporal differences in plant growth and root exudation of two
Brachiaria grasses in response to low phosphorus supply
Diferencias en el crecimiento y exudaciones radiculares de dos especies de
Brachiaria en respuesta a baja disponibilidad de fósforo
ANNA E. LOUW-GAUME1, NOEL SCHWEIZER1, IDUPULAPATI M. RAO2, ALAIN J. GAUME3 AND
EMMANUEL FROSSARD1
1 Group of Plant Nutrition, Institute of Agricultural Sciences, ETH Zurich, Lindau, Switzerland. www.plantnutrition.ethz.ch
2 International Center for Tropical Agriculture (CIAT), Cali, Colombia. www.ciat.cgiar.org
Presently: Plant Polymer Research Unit, National Center for Agricultural Utilization Research, ARS, USDA, Peoria,
IL, USA. www.ars.usda.gov
3 Syngenta Crop Protection, Münchwilen AG, Stein, Switzerland. www.syngenta.com
Abstract
Exploiting the natural variability of Brachiaria forage germplasm to identify forage grasses adapted to infertile acid soils
that contain very low available phosphorus (P) is an important research objective for improving livestock production in
the tropics. The objective of this study was to determine the differences in the release of root biochemical markers, i.e.
carboxylates and acid phosphatases (APases), during the development of P deficiency in signalgrass and ruzigrass. We
used the hydroxyapatite pouch system in hydroponics to simulate conditions of low P supply in acid soils to test the
response of well-adapted signalgrass ( Brachiaria decumbens cv. Basilisk, CIAT 606) and less-adapted ruzigrass
( B. ruziziensis cv. Kennedy, CIAT 654). We monitored shoot and root growth and other physiological and biochemical
components that are important for root functionality at weekly intervals for 3 weeks. We found that monocarboxylate
exudation was not associated with the plant’s physiological P status, while exudation of oxalate and secreted-APases
increased with declining plant P concentrations in both grasses. Ruzigrass showed higher exudation rates and grew faster
than signalgrass, but could not maintain its initial fast growth rate when P concentrations in plant tissue declined to
1.0 mg P/g dry matter. Oxalate was the dominant exuded carboxylate for signalgrass after 21 days of growth and this
response might confer some eco-physiological advantages in signalgrass when grown in low-P acid soils.
Keywords : Acid phosphatases, leaf expansion, oxalate, phosphate uptake and use, root elongation.
Resumen
El aprovechamiento de la variabilidad natural en germoplasma del género Brachiaria para identificar variedades
forrajeras adaptadas a suelos ácidos de baja fertilidad y bajo contenido de fósforo (P) disponible, es un objetivo de investigación importante con el fin de mejorar la producción ganadera en áreas tropicales. En el estudio se evaluaron las
diferencias en la exudación de carboxilatos y fosfatasas ácidas como marcadores bioquímicos radiculares durante el
desarrollo de deficiencia de P en 2 especies de Brachiaria. Para el efecto, se utilizó el sistema hidropónico de bolsas con
___________
Correspondence: Idupulapati M. Rao, Plant Polymer Research Unit,
National Center for Agricultural Utilization Research, Agricultural
Research Service, United States Department of Agriculture, 1815
North University Street, Peoria, IL 61604, USA.
Email: i.rao@cgiar.org; rao.idupulapati@ars.usda.gov
Tropical Grasslands-Forrajes Tropicales (ISSN: 2346-3775)
104 A.E. Louw-Gaume, N. Schweizer, I.M. Rao, A.J. Gaume and E. Frossard
hidroxiapatita para simular condiciones de baja disponibilidad de P en suelos ácidos, con el fin de identificar diferencias entre una gramínea adaptada ( Brachiaria decumbens cv. Basilisk, CIAT 606) y otra menos adaptada ( B. ruziziensis cv.
Kennedy, CIAT 654). Monitoreamos el crecimiento de las partes aéreas y las raíces de las plantas, así como algunos
componentes fisiológicos y bioquímicos importantes para la funcionalidad de las raíces, cada semana en un período de
3 semanas. Los resultados mostraron que la exudación de monocarboxilatos no estaba asociada con el estado fisiológico
de P de la planta, mientras que la exudación de oxalato y fosfatasas ácidas aumentó con la disminución de las
concentraciones de P en ambas gramíneas. Brachiaria ruziziensis mostró tasas de exudación más altas y creció más rápido que B. decumbens; no obstante su tasa de crecimiento rápido inicial se redujo cuando las concentraciones de P en
el tejido vegetal disminuyeron a 1.0 mg/g de materia seca. El oxalato fue el carboxilato exudado prevalente para
B. decumbens después de 21 días de crecimiento, una respuesta que aparentemente confiere algunas ventajas
ecofisiológicas a esta gramínea cuando se cultiva en suelos ácidos de bajo contenido de P disponible.
Palabras clave : Absorción y uso de fósforo, elongación radicular, expansión foliar, fosfatasas ácidas, oxalato.
Introduction
Carboxylates enhance Pi release through the
dissolution of calcium (Ca), iron (Fe) or aluminum (Al)
Adoption of Brachiaria forage grasses over the past 4
phosphates. However, little in vivo evidence for P
decades had a revolutionary impact on livestock produc-
mobilization by carboxylates exists, except that most P-
tivity in the tropics (White et al. 2013). Both signalgrass
deficient plants release higher amounts than P-sufficient
[ Brachiaria (now: Urochloa) decumbens cv. Basilisk,
plants (Ström et al. 2002). The organic acid anions most
CIAT 606] and ruzigrass [ Brachiaria (now: Urochloa)
effective at mobilizing P in soils are, in descending order,
ruziziensis cv. Kennedy, CIAT 654] are grown on infertile
tricarboxylate citrate and the dicarboxylates, oxalate and
acid soils that contain very low available phosphorus (P)
malate (Neumann and Römheld 2000; 2012). Carboxylate
levels, and are used for livestock production in the tropics
release also requires the counter release of a cation to
(Miles et al. 2004).
maintain charge balance. In the case of P deficiency, the
A comparative study by Louw-Gaume et al. (2010a;
rhizosphere pH has been shown to decline concurrently
2010b), using signalgrass and ruzigrass, analyzed the role
with carboxylate release, suggesting a balancing role for
of morphological and physiological responses of roots, as
proton (H+) efflux via H+-ATPases (Hinsinger et al. 2003;
plant mechanistic components to enhance P acquisition
Neumann and Römheld 2012). Two other likely
and P recycling within the plant. More specifically, plants
candidates in terms of counter ions are potassium (K) and
of both grasses grown under low-P conditions had higher
magnesium (Mg). Increased K+ concentrations in root
root biomass fractions and higher root tissue levels of acid
exudates suggest that carboxylate- and K+-effluxes are
phosphatases (APases) and phytases than plants grown
coupled (Ryan et al. 2001), while Zhu et al. (2005)
under high-P conditions. Interestingly, root morpholog-
reported the involvement of Mg2+ in P-limiting
ical traits of signalgrass were not responsive to variation
carboxylate release in white lupin. Benefits for P uptake
in P supply, while lateral root growth in ruzigrass was
resulting from the coupling of carboxylate release to K+-
significantly increased in plants grown at low P supply in
efflux have been shown by Palomo et al. (2006) as
hydroponic growth conditions.
rhizosphere alkalinization by K-citrate-enhanced P
Veneklaas et al. (2003) suggested that the key factor in
mobilization in a high P-fixing acid soil.
plant-soil interactions might be rhizosphere chemistry,
The objective of this study was to determine the
rather than root morphology. Mechanisms to increase
differences in the release of root biochemical markers, i.e.
inorganic P (Pi) availability in the rhizosphere include
carboxylates and APases, during the development of P
carboxylate exudation and APase secretion by plant roots
deficiency in signalgrass and ruzigrass. Our hypothesis
(Gaume et al. 2001; Lambers et al. 2006; Neumann and
was that exudation rates of both biochemical markers of
Römheld 2012). The induction of APases is a general
P deficiency will be augmented in P-deficient plants of
response of plants to Pi starvation and correlations
both grasses, but the 2 grasses could differ qualitatively
between the intracellular and/or extracellular APase
and quantitatively in their response, when grown for a
activity and cellular Pi status have been found (Vance et
short period of 21 days at low P supply. We used the
al. 2003; Nanamori et al. 2004).
hydroxyapatite pouch system in hydroponics (Sas et al.
Tropical Grasslands-Forrajes Tropicales (ISSN: 2346-3775)
Influence of phosphorus deficiency on root exudation 105
2001) to simulate low P supply conditions of infertile
physiological and biochemical responses of both grasses
tropical soils (Louw-Gaume et al. 2010a) and to
to low P supply. Plant responses were monitored at 3 time
investigate whether the release of carboxylates and
intervals, i.e. day 7 (D7), day 14 (D14) and day 21 (D21)
APases from roots is part of a temporally coordinated and
after inducing low P supply to one-week-old seedlings
targeted response to P limitation in signalgrass and
transferred to nutrient solution. This growth period was
ruzigrass. In addition to these physiological responses and
selected to focus on root-level mechanisms for P uptake
associated differences in plasticity, related mechanistic
during vegetative growth.
components such as exuded counter-ions for charge
Phosphate release in control containers (n = 6) without
balance and tissue levels of carboxylates were
plants was monitored and measured as 0.33 ± 0.02
investigated at weekly intervals for 3 weeks. Finally, as
Pi/d. The mean concentration of Pi on day 0 (day before
responses in leaf and root growth of Brachiaria grasses
introducing seedlings) was 1.00 ± 0.11 (n = 16), a Pi
might differ at low P supply (Rao et al. 1996; Louw-
level that is in agreement with the value of 1 Pi used
Gaume et al. 2010a, 2010b), we also examined these
by Wenzl et al. (2003) to simulate Pi level in soil solutions
morphological responses in order to obtain a whole-plant
of highly weathered acid soils. On a daily basis, the pH
perspective that might contribute to understanding
and Pi concentration of hydroponic solutions were
diversity in plant attributes for tolerance to low-P acid
measured, while the HAP-containing pouch was checked
soils that exists in Brachiaria germplasm (Rao et al. 1998;
daily for potential leakage and visible evidence of
Miles et al. 2004; Rao 2014).
bacterial growth. The complete nutrient solution,
including the pouches, was renewed on days 8 and 15
Materials and Methods
(D8 and D15). As described before (Louw-Gaume et al.
2010a), each hydroponic tank contained 2 replicates of
Plant growth and harvests
each grass and each replicate consisted of 3 plants. The
number of replicates was 10 for each grass (that is, 30
The experimental protocol for the germination of seeds
plants in total). The experiment was repeated and the data
and growth of a tetraploid, apomictic signalgrass
from the second experiment are reported, since this
[ Brachiaria (now: Urochloa) decumbens cv. Basilisk,
experiment included all measurements. Similar results
CIAT 606] and a diploid sexual ruzigrass [ Brachiaria
were observed in both experiments on biomass
(now: Urochloa) ruziziensis cv. Kennedy, CIAT 654] in
production, carboxylate composition and exudation rates
nutrient solution at pH 5.5, using the hydroxyapatite
for both grasses.
(HAP)/dialysis pouch system, was reported by Louw-
Three destructive harvests were performed following
Gaume et al. (2010a). Seeds were surface-sterilized and
the collection of root exudates at D7, D14 and D21,
germinated in the dark (25 °C) for 3 to 4 days on filter
starting at the same time of day for each harvest, as it has
paper saturated with deionized water. Seedlings were
been reported that rhizosphere processes for P
grown for one week in sand culture (with nutrient supply
mobilization exhibit a temporal variability (Neumann and
in mg/kg of sand: 2.6 P, 2.5 N, 3.1 K, 1.0 Ca, 0.38 Mg,
Römheld 2012). The dry matter (DM) per young seedling
0.38 S, 0.02 Zn, 0.03 Cu, 0.001 B, 0.001 Mo) in growth
(n = 10) before inducing low-P treatment was slightly
chambers with a day/night cycle of 12 h at 25 °C and 12
higher for ruzigrass than for signalgrass (37 vs. 32 mg
h at 18 °C, 60% relative humidity and a photon flux
DM). The shoot mass density of signalgrass seedlings was
density of 250 µmol/m2/sec. These conditions for early
higher than for ruzigrass (0.16 vs. 0.13 g DM/g fresh
seedling growth were used since Brachiaria grasses do
biomass). The nutrient concentrations (% of dry weight)
not display rapid early seedling growth level due to their
of the seedlings before low-P treatment were: 0.16 P, 0.19
small seed size. Selected seedlings of each grass with
S, 1.14 N and 44.5 C for the shoot tissue of signalgrass;
similar development were further grown in aerated
and 0.23 P, 0.31 S, 4.29 N and 42.0 C for the shoot tissue
nutrient solution (in mM: 0.25 NH4NO3, 0.53 KNO3, 0.75
of ruzigrass. For root tissue of the seedlings, the
Ca(NO3)2, 0.33 CaCl2, 0.42 MgSO4, 0.17 NaCl, 0.01
concentrations were: 0.07 P, 0.12 S, 1.14 N and 44.5 C in
FeNaEDTA; in µM: 30 H3BO3, 5 ZnSO4, 0.2 CuSO4, 10
signalgrass; and 0.08 P, 0.13 S, 1.36 N and 39.3 C in
MnCl2, 0.1 Na2MoO4) under the same controlled
ruzigrass. Plant material was dried for 4 d at 45 °C before
conditions. The hydroxyapatite/dialysis pouch system in
DM determination. Leaf area was recorded with a leaf
hydroponics was used to induce high-P (5 g of
area meter (Li-COR Model 3100, Lincoln, USA). The
hydroxyapatite) and low-P (1 g of hydroxyapatite) condi-
complete root system was scanned and root length was
tions (Louw-Gaume et al. 2010a). The current study
analyzed using WinRHIZO V3.09b root imaging
included only the low-P treatment to further characterize
software (Regent Inc., Quebec, Canada). The relative
Tropical Grasslands-Forrajes Tropicales (ISSN: 2346-3775)
106 A.E. Louw-Gaume, N. Schweizer, I.M. Rao, A.J. Gaume and E. Frossard
growth rate was calculated for each harvest interval,
AS10 column, in combination with suppressed con-
according to the method of Hoffmann and Poorter (2002).
ductivity, was used and the eluent was 50 m NaOH with
Rates of leaf expansion and root elongation between
a flow rate of 1 ml/min. The exudate samples were dried
harvests were calculated as the change in leaf area (in
and the pellets re-suspended in nanopure water prior to
cm2) or root length (in m) per day for the three 7-day
injection. The identification of carboxylates was
growth periods. For the determination of the plant P, K
confirmed by spiking with standards and carboxylate
and Mg concentrations, dried and milled plant material
release rates were expressed per unit of root length, i.e.
was incinerated at 550 °C, followed by solubilization in
nmol/m/h.
65% HNO3 and analysis with ICP-emission spectroscopy
(Louw-Gaume et al. 2010b).
Effluxes of H+, K+, Mg2+ and NO3‾
Collection of root exudates and pH measurement in CaCl2
At each harvest time, the pH of CaCl2-exudate solutions
traps
increased from 5.5 to values above 6 for both grasses over
the 6-h exudation period. These increases were converted
At each sampling plants were removed from hydroponic
into proton equivalents and expressed as the relative
containers and root systems were washed twice in 0.1 mM
change in protons. Efflux rates of K+ and Mg2+ were
CaCl2 solution (pH 5.5, adjusted with HCl) to eliminate
determined by analyzing the K and Mg concentrations in
possible interference from remaining nutrients close to
the CaCl2 solutions with ICP-emission spectroscopy. The
root systems during the exudation steps. Great care was
CaCl2 solutions were also analyzed for the presence of
taken when handling root systems to avoid tissue damage.
nitrate (NO3‾) using a flow injection analyzer (SKALAR
The first exudation step was performed for 6 h in aerated
San++ System, Netherlands). The relative change in
0.1 mM CaCl2 (pH 5.5) solution containing 0.01% (v/v)
protons and efflux rates of K+, Mg2+ and NO3‾ were
protease inhibitor cocktail (Sigma, P2714) under the same
expressed per unit of root length, i.e. mol protons, K+,
growth chamber conditions as for plant growth. The
Mg2+/m/h and nmol NO
second step was carried out for 1 h at 4 oC in 0.1 mM NaCl
3‾/m/h.
(pH 5.5, adjusted with HCl) with the same inhibitor
Acid phosphatase and phytase activity
cocktail. Exudation volumes were adjusted at each
harvest time to compensate for different plant sizes. For
Acid phosphatase activities detected in the CaCl2 and
example, at D7, the exudation volume was 30 ml per
NaCl solutions were grouped as secreted APases
bunch of 3 plants for both grasses and 80 ml and 110 ml
(sAPases) and cell-wall-associated APases (cwAPases),
for signalgrass and ruzigrass, respectively, at D21. The
respectively. Root exudate solutions were concentrated
pH was measured at the end of the 6-h period in the CaCl2
with centrifugal filters (Amicon Ultra-15, Millipore,
solutions. Exudates were centrifuged at low speed (4 oC)
USA) for the detection of phytase activity. The activities
for 3 min, filtered through 0.2-μm syringe filters and
of acid phosphomonoesterases and phytases were
stored at -80 oC until assayed. These steps were in line
determined as described by Louw-Gaume et al. (2010b).
with recommendations by Gaume et al. (2001) and
Enzyme activities were expressed as enzyme units (U)
Neumann and Römheld (2000).
per unit root length, where 1 U releases 1 mol Pi/min.
Carboxylate extraction and determination
Statistical analysis
The roots were washed with de-ionized water and blotted
dry with paper towels, frozen in liquid nitrogen and stored
The Welch two sample t-test was used to determine
at -80 oC until extraction. The method of Zindler-Frank et
differences between species and between harvest intervals
al. (2001) was slightly modified and soluble oxalate was
(R Core Team 2014).
extracted by grinding frozen leaf and root material in warm
(50 oC) deionized water, followed by heating at 80 oC for
Results
30 min, bench-top centrifugation, filtration through 0.2-μm
syringe filters and acidification with HCl to pH 3‒4. These
Biomass production and plant P concentrations
extracts were also used for the determination of glycolate.
The carboxylates in vacuum-concentrated CaCl2
The total biomass production increased between
solutions were analyzed by ion chromatography (Dionex
sequential harvests for both grasses, but ruzigrass pro-
DX 500 System, Dionex Corporation, USA). An Ion Pac
duced more biomass at each harvest time (Figure 1A).
Tropical Grasslands-Forrajes Tropicales (ISSN: 2346-3775)
Influence of phosphorus deficiency on root exudation 107
Figure 1B shows that ruzigrass could not maintain its
levels were similar for both grasses at subsequent harvests,
relative rate of biomass production after D14 (14 days
reaching about 1.0 mg P/g DM at D21.
after inducing low-P treatment) and the relative growth
rate declined by 30%, to a level similar to that maintained
Carboxylates in root exudates and in tissues
by signalgrass throughout. Rate of leaf expansion in-
creased strongly between D7 and D14, with a smaller
Figure 3A shows exudation rates and composition of
increase in rate from D14 to D21, while rate of root
organic acid anions, i.e. acetate, glycolate, formate, lactate
elongation for ruzigrass was much greater between D14
(monocarboxylates) and oxalate (dicarboxylate). Citrate
and D21 than for the other periods (Figures 1C and 1D,
(tricarboxylate) and malate (dicarboxylate) could not be
respectively). Root diameter was not affected by
detected in the root exudates of either grass. The combined
decreasing plant-P concentrations, although signalgrass
exudation rates of all carboxylates for ruzigrass were 115%
had thinner roots at each harvest time (results not shown).
greater than those for signalgrass at D7, 240% greater at
Plant-P concentrations in both grasses declined with age
D14 and only 55% greater at D21. The temporal patterns
with a greater reduction for ruzigrass than for signalgrass
of monocarboxylate exudation did not differ between
(Figure 2). P concentration in ruzigrass at D7 was much
grasses, with rates decreasing after D7 (Figure 3B), but
greater than for signalgrass (3.8 vs. 2.1 mg/g DM) but
then increasing slightly between D14 and D21. In contrast,
Figure 1. Morphological attributes of signalgrass and ruzigrass at day 7 (D7), day 14 (D14) and day 21 (D21) after inducing low-P
treatment under hydroponic conditions. (A) Total dry biomass (DM). (B) Relative growth rate (mg/mg/d) for each of the 3 harvest intervals, i.e. D0-D7 (first harvest interval), D7-D14 (second harvest interval) and D14-D21 (third harvest interval), where D0 refers to the start of the experiment and the day on which young seedlings were prepared for experimental use. (C) Rate of leaf expansion (cm2/d). (D) Rate of root elongation (m/d). Means for a specific harvest time or harvest interval with different letters indicate significant differences between grasses (P<0.05).
Tropical Grasslands-Forrajes Tropicales (ISSN: 2346-3775)
108 A.E. Louw-Gaume, N. Schweizer, I.M. Rao, A.J. Gaume and E. Frossard
fraction at D7 and D14 was greater for ruzigrass than for
signalgrass (5 and 31% vs. 1 and 17%, respectively). By
D21 the level in signal grass had increased to 45%, while
the level in ruzigrass remained at 31%. Patterns of lactate
exudation were similar in both grasses, being high at both
D7 and D21 with very low levels at D14. At D21
signalgrass had a higher oxalate:lactate ratio than
ruzigrass (1.7 vs. 0.5). For both grasses, the temporal
patterns for glycolate and formate fractions were similar;
absolute levels of exudation did not vary over time as
much as levels of acetate, oxalate and lactate but the
percentages of total exudation fluctuated because of
changes in the other components.
Tissue concentrations of soluble oxalate and glycolate
are shown in Table 1. For each grass, leaf and root oxalate
concentrations did not change between D7 and D14. At
Figure 2. Plant-P concentrations of signalgrass and ruzigrass
these harvest times, signalgrass had greater leaf:root
at day 7 (D7), day 14 (D14) and day 21 (D21), expressed as mg
oxalate ratios than ruzigrass due to oxalate concentrations
P/g DM, after inducing low-P treatment under hydroponic
in signalgrass being higher in leaves and lower in roots
conditions. Vertical bars represent ± s.e. (n = 30).
than those of signalgrass. Leaf oxalate concentrations in
signalgrass decreased after D14, while for ruzigrass, both
patterns of oxalate exudation differed between grasses
leaf and root oxalate concentrations declined. Glycolate
(Figure 3C) with rate increasing throughout for signalgrass
concentrations were up to 30 times those of oxalate in
but peaking at D14 for ruzigrass. Final levels at D21 were
both grasses. In addition, leaf glycolate concentrations
similar for both grasses.
showed moderate temporal variation, with lowest values
The carboxylate composition of root exudates changed
at D14, while root glycolate levels changed in a similar
over time for both grasses (Figure 3A). The oxalate
way to oxalate levels in each grass.
Figure 3. Root exudation rates (nmol/m/h) of carboxylates by signalgrass and ruzigrass at day 7 (D7), day 14 (D14) and day 21 (D21) after inducing low-P treatment under hydroponic conditions. (A) Total root exudation rates and carboxylate composition. Different letters indicate significant differences between grasses for total root exudation rate at a specific harvest. (B) Rates of monocarboxylate root exudation, including acetate, glycolate, formate and lactate. (C) Rates of oxalate root exudation.
Tropical Grasslands-Forrajes Tropicales (ISSN: 2346-3775)
Influence of phosphorus deficiency on root exudation 109
Table 1. Tissue concentrations (nmol/g fresh mass) and leaf:root ratios of oxalate and glycolate for signalgrass and ruzigrass at day 7 (D7), day 14 (D14) and day 21 (D21) after inducing low-P treatment under hydroponic conditions.
Carboxylate
Harvest
Signalgrass
Ruzigrass
Leaf (L)
Root (R)
L:R ratio
Leaf (L)
Root (R)
L:R ratio
Oxalate
D7a
53a1
17a
3.1 1
44b
22b
2.01
D14a
61a
16a
3.8 1
45b
27b
1.71
D21a
39a
18a
2.2 1
33a
13b
2.51
Glycolate
D7a
1,379a
415a
3.3 1
1,354a
646b
2.11
D14a
960a
471a
2.0 1
1,215b
814b
1.51
D21a
1,364a
448a
3.0 1
1,601a
329b
4.91
1Within rows and plant parts, values followed by different letters are different (P<0.05).
Changes in proton equivalents and efflux rates of K+,
during this short experimental period of 21 days that
Mg2+and NO3‾ and root concentrations of K and Mg
focused on plant mechanisms and associated plasticity for
P uptake during early vegetative growth. However, the
The relative change in proton equivalents (Figure 4A) was
growth of ruzigrass was compromised during the
greater for signalgrass than for ruzigrass at D7, but
development of P deficiency; while ruzigrass grew very
grasses did not differ at D14 and D21. For both grasses
fast initially, it could not maintain its relative growth rate
the lowest values were recorded at D21 (i.e. pH increased
and strong leaf expansion after D14. In addition, plant-P
to a lesser extent from the value of 5.5 after D14). Rates
concentrations declined after D14 to below 2.0 mg P/g
of efflux of NO3‾ (Figure 4B), K+ (Figure 4C) and Mg2+
DM, indicating that ruzigrass started to economize on Pi.
(Figure 4D) generally increased with time, while root
Veneklaas et al. (2012) suggested that the reduction in
concentrations of K and Mg declined over time (Figures
growth is not a direct consequence of low shoot-P status,
4E and 4F).
but of signaling events that can be genetically controlled.
Lambers et al. (2008) also reported that roots sense that
Temporal patterns of APase secretion and phytase pro-
nutrients such as N and P are limiting well before leaves
portion
experience deficiency symptoms, indicating that shoot
growth is regulated in a feed-forward manner.
Rates of secretion of sAPases were similar in both grasses
Critical shoot-P concentrations in Brachiaria grasses
at D7 and D21, but ruzigrass had a much higher secretion
are around 1.0 mg P/g DM (Rao 2001). For ruzigrass, the
rate at D14 than signalgrass (Figure 5A). For both grasses,
key factor responsible for high P uptake and high initial P
cwAPase release rates increased only after D14, by 2-fold
concentrations might be a faster growth rate as suggested
in signalgrass and 6-fold in ruzigrass (Figure 5B).
by Lambers and Poorter (2004). In contrast, signalgrass
Compared with sAPases at D21, rates of cwAPases were
had lower P uptake and P concentration in tissue initially,
3-fold higher in signalgrass and 10-fold higher in
resulting in lower growth rates. This balanced growth rate
ruzigrass. Extracellular phytases could be detected only at
may ensure that nutrient demand does not exceed its
D21 in both the CaCl2- and NaCl-collections. Phytase
supply.
proportions (as a percentage of the total APase pool) were
low for both grasses, but were slightly higher in the
Release of oxalate and APase are linked to decreasing
cwAPase pool than in the sAPase pool.
plant-P concentrations
Discussion
Our results suggest that oxalate and APases are involved
in the P-nutrition of both Brachiaria grasses as temporal
Low P supply reduced biomass production and leaf
associations between decreases in plant-P concentrations
expansion in ruzigrass
and increases in the exudation of these biochemical
attributes were evident. The release of both components
In agreement with earlier findings (Louw-Gaume et al.
might also form part of a coordinated adaptive strategy
2010a), ruzigrass was a faster-growing grass and
and functional synergy between oxalate and APases,
produced more biomass than signalgrass at low P supply
which could improve acquisition of P in low-P acid soils
Tropical Grasslands-Forrajes Tropicales (ISSN: 2346-3775)
110 A.E. Louw-Gaume, N. Schweizer, I.M. Rao, A.J. Gaume and E. Frossard
Figure 4. Relative change in proton equivalents (mol/m/h) and efflux rates of NO3‾ (nmol/m/h), K+ (mol/m/h) and Mg2+ (mol/m/h) and K and Mg concentrations (mg/g) in roots of signalgrass and ruzigrass at day 7 (D7), day 14 (D14) and day 21 (D21) after inducing
low-P treatment under hydroponic conditions. (A) Change in pH (from pH 5.5) expressed as relative change in proton equivalents. (B) Rate of NO3‾-efflux. (C) Rate of K+-efflux. (D) Rate of Mg2+-efflux. (E) Root K concentrations. (F) Root Mg concentrations.
Figure 5. Root exudation of APases (U/m) by signalgrass and ruzigrass at day 7 (D7), day 14 (D14) and day 21 (D21) after inducing low-P treatment under hydroponic conditions. (A) Rate of secreted APases collected in CaCl2 solution. (B) Rate of cell-wall-associated APases collected in NaCl solution. Activity of extracellular phytase was detected only at D21 and its percentage of the
total pool of APases is indicated in the left upper corner of each graph.
Tropical Grasslands-Forrajes Tropicales (ISSN: 2346-3775)
Influence of phosphorus deficiency on root exudation 111
as carboxylates can enhance the solubility of not only
Acquisition of P from phytate by phytases could
inorganic P, but also organic soil-P forms, which are
potentially provide plants with an alternative organic P
subsequently hydrolyzed by phosphatases (Vance et al .
source (Richardson et al. 2005). Louw-Gaume et al.
2003; Jones et al. 2004; Playsted et al. 2006).
(2010b) reported higher root tissue levels of APases and
The increase in exudation of oxalate and sAPases by
phytases for plants grown under low-P conditions with
roots could be associated with decreases in P
phytase proportions representing less than 1% of the total
concentrations in each grass. These traits increased during
APase pool in root tissue, while the present study found
early growth, together with the first decline in plant-P
higher phytase proportions in both the sAPase and
concentrations in ruzigrass, supporting as well a higher
cwAPase pools (2 and 5%, respectively). Interestingly,
growth demand for P in this grass. While rate of exudation
the grasses we studied did not differ with regard to
of carboxylate and sAPase by ruzigrass peaked at D14,
phytase fractions in either study. Our results are at
secretion of cwAPase increased sharply during the next 7
variance with the findings by Li et al. (1997), who
days, when plant-P concentrations declined further and
reported high levels of phytase secretion in P-deficient
biomass production would have been compromised. It is
B. decumbens plants. The experimental system used in
important to emphasize that, although root exudation
simulating low-P supply conditions in the hydroponics
responses of ruzigrass after D14 appeared to level off,
growth medium might explain these differences. Our
root elongation increased strongly after D14. Thus, if root
results support the observations of Hayes et al. (1999),
growth was stimulated while exudation rates were
who reported that phytase activity constituted only a small
maintained during P-limited growth, the key factor to
component (less than 5%) of the total APase activity in
consider was total below-ground output of carboxylates,
various plants.
which might be higher for ruzigrass. Louw-Gaume et al.
(2010a) also showed that lateral root growth was
Oxalate exudation may enhance P acquisition in acid
stimulated in ruzigrass only when grown at low P supply.
tropical soils
Interestingly, Hütsch et al. (2002) reported that cultivar
differences in total amounts of root-released C could be
Oxalate exudation in response to P deficiency has been
attributed to root length.
reported in sugarbeet (Gerke et al. 2000), soybean (Dong
Furthermore, it appears that root morphological
et al. 2004), rice (Hoffland et al. 2006) and Banksia
plasticity in ruzigrass is associated with a high level of
species (Denton et al. 2007) and our results for both
root physiological plasticity as evident from the strong
Brachiaria grasses are consistent with these observations.
induction of cwAPases by plant P concentrations below 2
Pentanedioic acid and oxalic acid were also dominant
mg P/g DM. This finding also suggests a dependence on a
exuded organic acids in P-deficient elephantgrass
critical threshold of Pi depletion as a signal for enzymatic
( Pennisetum purpureum), another tropical forage grass
cwAPase induction (Jain et al. 2007). In white lupin,
(Shen et al. 2001). Dong et al. (2004) also noted that
secretory APases were produced not only by tap root
exudation of oxalate rather than other carboxylates may
epidermal cells, but also in the cell walls and intercellular
present higher physiological efficiency, as less C and
spaces of lateral roots. Such apoplastic phosphatases are
energy are consumed during exudation.
protected from inactivation by various soil processes, but
Hydroponic experiments provide only indirect
effectiveness depends on the presence of soluble
evidence and the functional significance of carboxylate
organophosphates in soil solution (Neumann and
exudation in a real soil environment remains unknown
Römheld 2007; 2012). Although the enzymatic
(Jones et al. 2004; Neumann and Römheld 2012).
hydrolysis of root-secretory phosphatase is limited by the
Observed exudation rates cannot be compared with those
low solubility of organic P forms in soils (Neumann and
of leguminous plants as their carboxylate effluxes are 10
Römheld 2012), higher phosphatase activities in the
to 50 times higher than for graminaceous species (Gerke
rhizosphere have been reported to contribute to the
et al. 2000). In soils with low P-availability, competition
depletion of organic P from Oxisols containing very low
by carboxylates for P-sorption sites might be of greater
available P (George et al. 2006). In signalgrass, exudation
significance than P-desorption mechanisms, which
responses of all 3 biochemical markers for P limitation,
require high concentrations of carboxylates such as citrate
i.e. oxalate and both groups of APases, were temporally
and oxalate. Huguenin-Elie et al. (2003), using a
coordinated and increased only after D14.
modeling approach, showed that low release rates of
Tropical Grasslands-Forrajes Tropicales (ISSN: 2346-3775)
112 A.E. Louw-Gaume, N. Schweizer, I.M. Rao, A.J. Gaume and E. Frossard
citrate could account for 90% of the P uptake of rice
The higher rate of formate exudation in signalgrass
grown under aerobic conditions. Furthermore, average
was also interesting, as Tanaka et al. (1995) suggested that
values integrated over the whole root system can be
formate could solubilize Fe-P forms due to its strong
misleading and may result in erroneous conclusions about
reducing capacity, based on observations of increased
nutrient relationships in the rhizosphere, due to spatial
formate secretion in P-deficient Arachis hypogaea.
variability of exudation along the root axis (Neumann and
Dinkelaker et al. (1995) also proposed that increased
Römheld 2000; 2012).
reductive capacity in roots may be another P-adaptive
Fox and Comerford (1992) suggested that the
response.
cumulative oxalate loading rate contributes to the
Oxalate exudation might be an important strategy for
solubilization of large amounts of P on an annual basis
Al resistance, as Al-toxicity and P-deficiency co-exist in
and this might be relevant for the survival of the grasses
acid soils and both are major constraints for productivity
used in our study. Furthermore, the effectiveness of
of Brachiaria pastures (Miles et al. 2004). Carboxylate
oxalate was shown in both calcareous and acid soils
exudation could not be linked to external Al
treated with monocalcium phosphate and phosphate rock
detoxification in either grass (Wenzl et al. 2001), but a
(Fox and Cromerfold 1992; Ström et al. 2002), suggesting
low-P background might have obscured responses (Liao
that oxalate exudation by signalgrass and ruzigrass might
et al. 2006). Interestingly, phytosiderophore-mediated
have significance for enhanced P-acquisition in acid soils.
iron release from goethite is also enhanced by oxalate
Application of rock phosphates to acid soils has been
(Marschner et al. 2011) and thus, oxalate might also be
suggested (Fardeau and Zapata 2002) and their suitability
important for Fe uptake from iron oxides in both
as P fertilizer for signalgrass has been demonstrated
Brachiaria grasses.
(Lopes et al. 1991). Araújo et al. (2003) also reported
greater importance for the acid-soluble P fraction than for
Are Mg2+ ions involved in charge balance during oxalate
the NaOH-extractable fraction in a pot experiment using
exudation?
B. decumbens. As signalgrass is better adapted to and
more persistent on infertile acid soils that contain very
Our observations reiterate that interpretation of pH
low available P than ruzigrass (Miles et al. 2004; Rao
changes in the rhizosphere should be considered with
2014), signalgrass might have a selective ecophysio-
caution (Hinsinger et al. 2003; Neumann and Römheld
logical advantage over the long term due to the dominance
2012). The greater pH of CaCl2-containing root exudates
of oxalate plus its slower and more balanced growth rate
may be attributed to lower Ca2+ uptake (versus Cl‾)
and associated implications for higher plant carbon (C)
(Hinsinger et al. 2003). In B. dictyoneura Hylander and
use efficiency (Louw-Gaume et al. 2010b). Leaf oxalate
Ae (1999) also reported an increase in the rhizosphere pH
concentrations were also higher for signalgrass,
due to higher amounts of basic cations and proton
consistent with higher oxalate levels reported for slower-
neutralization. However, the pH of nutrient solutions with
growing plants (Libert and Franceschi 1987).
growing plants declined over time and ruzigrass showed
Although lactate appears to be commonly exuded by
greater capacity to lower the pH (observed in pre-
plant species that are adapted to acid soils (Tyler and Ström
experiments), so we adopted the practice of growing both
1995), the finding that lactate was the dominant exuded
grasses in the same hydroponic container to eliminate
carboxylate in ruzigrass at D21 was unexpected, as the
interferences from the addition of KOH that was used for
presence of lactate has also been linked to detoxification
pH control. Proton release has also been linked to
that could be associated with cytoplasmic acidosis
differential cation/anion uptake (Hinsinger et al. 2003),
(Neumann and Römheld 2000). It is possible that, despite
consistent with the report by Logan et al. (2000), who
its high biomass production, high P uptake and high
found that plant-induced acidity by B. humidicola and
exudation rates of biochemical traits important for P-
B. brizantha was not due to low P-availability, but to
mobilization in acid soils, ruzigrass might start to
adequate supply of nutrients for growth.
experience metabolic complications in maintaining cellular
Our study focused on the most likely counter-cation
Pi homeostasis over a longer growth period (Veneklaas et
candidates to accompany carboxylate efflux (Ryan et al.
al. 2012). In addition, C-costs related to exudation (Dilkes
2001; Zhu et al. 2005). Interest in K+-efflux and root-K
et al. 2004) might have been substantial in ruzigrass, as
levels also stems from the finding that the K or sodium
faster-growing grasses deposit more C than species adapted
salt of oxalate is predominantly found in grasses (Jones
to infertile soils (Warembourg et al. 2003).
and Ford 1971). The two grasses did not differ in the
Tropical Grasslands-Forrajes Tropicales (ISSN: 2346-3775)
Influence of phosphorus deficiency on root exudation 113
pattern of K+-efflux, which increased strongly after D7.
Our results support the notion that increased
Marschner et al. (1997) reported that K+ functions in
carboxylate biosynthesis in plants is a physiological
charge
balance,
especially
in
NO3‾-fed
plants,
alteration associated with the preferential root exudation
participating as well in translocation of carboxylates and
of carboxylates with highest efficiency in P mobilization
soluble sugars. Interestingly, an increase in NO3‾-efflux
under conditions of P limitation (Neumann and Römheld
after D14 was observed only in signalgrass, supporting
2007).
higher NO3‾-efflux rates as reported in slow-growing
plants (Nagel and Lambers 2002). Root-K concentrations
Conclusions
decreased for both grasses as reported during P deficiency
in white lupin (Sas et al. 2002) and the Brachiaria hybrid
The experimental approach used in this study highlights
cv. Mulato (Watanabe et al. 2006).
the importance of adopting an eco-physiological
Despite these uncertainties for H+ and K+, Mg2+
perspective to understand developmental, physiological
appears to be a counter-ion for oxalate efflux as its efflux
and biochemical aspects of adaptation to low-P stress in
pattern corresponded well with the release curves of
Brachiaria grasses. Furthermore, a comparison of species
oxalate in both species. Zhu et al. (2005) reported that
differences in adaptation to limiting P supply became
Mg2+ was involved in carboxylate release of white lupin
feasible by studying, simultaneously, temporal responses
during P deficiency. Increases in Mg2+-efflux by roots
of: (i) whole-plant growth together with variations in both
also corresponded in a timely manner with decreases in
root and leaf attributes; and (ii) root-induced changes in
root concentrations of Mg in each grass.
the rhizosphere that determine nutrient availability and
Another consideration is that cation-efflux rates were
influence plant growth. Results from this study indicate
higher than those of carboxylates. Deficiency of P
that growth may be faster for ruzigrass than for
enhances membrane leakiness (Neumann and Römheld
signalgrass during early establishment in low-P soils but
2007), suggesting that the likelihood of higher non-
ruzigrass may demand higher P supply to sustain its
specific efflux during P limitation cannot be excluded.
higher growth rate. Further research is needed on soil-
grown plants of both grasses to characterize changes in
Glycolate might be an oxalate precursor
rhizosphere induced by exudation of organic acids and
phosphatases from roots.
As expected, monocarboxylate exudation could not be
related to the plant-P status in the current study, but our
Acknowledgments
results on monocarboxylate composition and exudation
patterns could have significance for C utilization. Oxalate
Seeds of signalgrass and ruzigrass were provided by the
can be formed from photorespiratory glyoxylate via
International Center for Tropical Agriculture (CIAT),
glycolate, catalyzed by glycolate oxidase (Franceschi and
Cali, Colombia. This project was part of the research
Nakata 2005). In both grasses we used glycolate might
program of the North-South Centre of the Swiss Federal
be an oxalate precursor, as leaf glycolate levels were
Institute of Technology (ETH-Zurich) “Livestock system
significantly higher than those of oxalate and, in addition,
research in support of poor people”. It was jointly funded
leaf oxalate levels decreased after D14, while leaf
by the ETH-Zurich and the Swiss Agency for
glycolate levels increased. Interestingly, Ueno et al.
Development and Cooperation (SDC), Switzerland.
(2005) studied 28 C4 grasses (ruzigrass not included) and
found activity of glycolate oxidase was greatest in
References
B. brizantha and B. decumbens.
While oxalate exudation increased after D14 in
Araújo MSB; Schaefer CER; Sampaio EVSB. 2003. Plant
signalgrass and also ruzigrass (when increases in root
phosphorus availability in latosols and luvisols from
elongation are considered), leaf oxalate concentrations
northeastern semi-arid Brazil. Communications in Soil
decreased for both grasses, suggesting that leaves might
Science and Plant Analysis 34:407–425. DOI: 10.1081/
be the site of oxalate biosynthesis, as reported by Ji and
Denton MD; Veneklaas EJ; Lambers H. 2007. Does phenotypic
Peng (2005). Root levels of oxalate and glycolate did not
plasticity in carboxylate exudation differ among rare and
change over time in signalgrass, but both decreased
widespread Banksia species (Proteaceae)? New Phytologist
strongly in P-deficient ruzigrass plants. Carboxylate
173:592–599. DOI: 10.1111/j.1469-8137.2006.01956.x
efflux has been correlated with intracellular root
Dilkes NB; Jones DL; Farrar J. 2004. Temporal dynamics of
concentrations, but Ryan et al. (2001) pointed out that
carbon partitioning and rhizodeposition in wheat. Plant
membrane processes appear to be the key step for efflux.
Physiology 134:706–715. DOI: 10.1104/pp.103.032045
Tropical Grasslands-Forrajes Tropicales (ISSN: 2346-3775)
114 A.E. Louw-Gaume, N. Schweizer, I.M. Rao, A.J. Gaume and E. Frossard
Dinkelaker B; Hengeler C; Marschner H. 1995. Distribution
in soils. Journal of Plant Nutrition and Soil Science
and function of proteoid roots and other root clusters.
165:397–407. DOI: 10.1002/1522-2624(200208)165:4%3C
Botanica Acta 108:183–200. DOI: 10.1111/j.1438-8677.
Hylander L; Ae N. 1999. Nutrient distribution around roots of
Dong D; Peng X; Yan X. 2004. Organic acid exudation induced
Brachiaria, maize, sorghum, and upland rice in an andisol.
by phosphorus deficiency and/or aluminium toxicity in two
Soil Science and Plant Nutrition 45:617–626. DOI:
contrasting soybean genotypes. Physiologia Plantarum
10.1080/00380768.1999.10415825
122:190–199. DOI: 10.1111/j.1399-3054.2004.00373.x
Jain A; Vasconcelos MJ; Raghothama KG; Sahi SV. 2007.
Fardeau J-C; Zapata F. 2002. Phosphorus fertility recapi-
Molecular mechanisms of plant adaptation to phosphate
talization of nutrient-depleted tropical acid soils with
deficiency. Plant Breeding Reviews 29:359–419. DOI:
reactive phosphate rock: An assessment using the isotopic
exchange technique. Nutrient Cycling in Agroecosystems
Ji X-M; Peng X-X. 2005. Oxalate accumulation as regulated by
63:69–79. 10.1023/A:1020583804556
nitrogen forms and its relationship to photosynthesis in rice
Fox TR; Comerford ND. 1992. Influence of oxalate loading on
( Oryza sativa L.). Journal of Integrative Plant Biology
phosphorus and aluminum solubility in Spodosols. Soil
47:831–838. DOI: 10.1111/j.1744-7909.2005.00099.x
Science Society of America Journal 56:290–294. DOI:
Jones DL; Hodge A; Kuzyakov Y. 2004. Plant and mycorrhizal
10.2136/sssaj1992.03615995005600010046x
regulation of rhizodeposition. New Phytologist 163:459–
Franceschi VR; Nakata PA. 2005. Calcium oxalate in plants:
480. DOI: 10.1111/j.1469-8137.2004.01130.x
formation and function. Annual Review of Plant Biology
Jones RJ; Ford CW. 1972. Some factors affecting the oxalate
56:41–71. DOI: 10.1146/annurev.arplant.56.032604.144106
content of the tropical grass Setaria sphacelata. Australian
Gaume A; Mächler F; De León C; Narro L; Frossard E. 2001.
Journal of Experimental Agriculture and Animal Husbandry
Low-P tolerance by maize ( Zea mays L.) genotypes:
12:400–406. DOI: 10.1071/ea9720400
Significance of root growth, and organic acids and acid
Lambers H; Poorter H. 2004. Inherent variation in growth rate
phosphatase root exudation. Plant and Soil 228:253–264.
between higher plants: A search for physiological causes and
ecological consequences. Advances in Ecological Research
George TS; Turner BL; Gregory PJ; Cade-Menun BJ;
34:283–362. DOI: 10.1016/S0065-2504(03) 34004-8
Richardson AE. 2006. Depletion of organic phosphorus
Lambers H; Shane MW; Cramer MD; Pearse SJ; Veneklaas EJ.
from Oxisols in relation to phosphatase activities in the
2006. Root structure and function for efficient acquisition of
rhizosphere. European Journal of Soil Science 57:47–57.
phosphorus: Matching morphological and physiological
DOI: 10.1111/j.1365-2389.2006.00767.x
traits.
Annals
of
Botany
98:693–713.
DOI:
Gerke J; Beissner L; Römer W. 2000. The quantitative effect of
chemical phosphate mobilization by carboxylate anions on
Lambers H; Chapin FS; Pons TL. 2008. Plant physiological
P uptake by a single root. I. The basis concept and
ecology. 2nd Edn . Springer, New York, USA. DOI:
determination of soil parameters. Journal of Plant Nutrition
and Soil Science 163:207–212. DOI: 10.1002/(sici)1522-
Li M; Osaki M; Rao IM; Tadano T. 1997. Secretion of phytase
2624(200004)163:2%3C207::aid-jpln207%3E3.0.co;2-p
from the roots of several plant species under phosphorus-
Hayes JE; Richardson AE; Simpson RJ. 1999. Phytase and acid
deficient conditions. Plant and Soil 195:161–169. DOI:
phosphatase activities in extracts from roots of temperate
pasture grass and legume seedlings. Australian Journal of
Liao H; Wan H; Shaff J; Wang X; Yan X; Kochian LV. 2006.
Plant Physiology 26:801–809. DOI: 10.1071/pp99065
Phosphorus and aluminum interactions in soybean in
Hinsinger P; Plassard C; Tang C; Jaillard B. 2003. Origins of
relation to aluminum tolerance. Exudation of specific
root-mediated pH changes in the rhizosphere and their
organic acids from different regions of the intact root
responses to environmental constraints: a review. Plant and
system. Plant Physiology 141:674–684. DOI: 10.1104/
Soil 248:43–59. DOI: 10.1023/a:1022371130939
Hoffland E; Wei C; Wissuwa M. 2006. Organic anion
Libert B; Franceschi VR. 1987. Oxalate in crop plants. Journal
exudation by lowland rice ( Oryza sativa L.) at zinc and
of Agriculture and Food Chemistry 35:926–938. DOI:
phosphorus deficiency. Plant and Soil 283:155–162. DOI:
Logan KAB; Thomas RJ; Raven JA. 2000. Effects of
Hoffmann WA; Poorter H. 2002. Avoiding bias in calculations
ammonium and phosphorus supply on H+ production in gel
of relative growth rate. Annals of Botany 90:37–42. DOI:
by two tropical forage grasses. Journal of Plant Nutrition
23:41–54. DOI: 10.1080/01904160009381996
Huguenin-Elie O; Kirk GJD; Frossard E. 2003. Phosphorus
Lopes AS; Goedert WJ; Guilherme LRG. 1991. Use of natural
uptake by rice from soil that is flooded, drained or flooded
and modified phosphate rocks on annual, perennial and
then drained. European Journal of Soil Science 54:77–90.
forestry crops in Brazil. Revista de la Facultad de
DOI: 10.1046/j.1365-2389.2002.00489.x
Agronomia (Maracay) 17:67–95.
Hütsch BW; Augustin J; Merbach W. 2002. Plant
Louw-Gaume AE; Rao IM; Gaume AJ; Frossard E. 2010a. A
rhizodeposition – an important source for carbon turnover
comparative study on plant growth and root plasticity
Tropical Grasslands-Forrajes Tropicales (ISSN: 2346-3775)
Influence of phosphorus deficiency on root exudation 115
responses of two Brachiaria forage grasses grown in
phosphatase under phosphorus deficiency in Caustis blake i
nutrient solution at low and high P supply. Plant and Soil
(Cyperaceae). New Phytologist 170:491–500. DOI:
328:155–164. DOI: 10.1007/s11104-009-0093-z
10.1111/j.1469-8137.2006.01697.x
Louw-Gaume AE; Rao IM; Frossard E; Gaume A. 2010b.
R Core Team. 2014. R: A language and environment for
Adaptive strategies of tropical forage grasses to low
statistical computing. R Foundation for Statistical
phosphorus stress: The case of Brachiaria grasses. In:
Computing, Vienna, Austria. www.r-project.org/
Pessarakli M, ed. Handbook of plant and crop stress. 3rd
Rao IM. 2001. Role of physiology in improving crop adaptation
Edn. CRC Press, Boca Raton, FL, USA. p. 1111–1144. DOI:
to abiotic stresses in the tropics: The case of common bean
and tropical forages. In: Pessarakli M, ed. Handbook of
Marschner H; Kirkby EA; Engels C. 1997. Importance of
plant and crop physiology. CRC Press, Boca Raton, FL,
cycling and recycling of mineral nutrients within plants for
USA. p. 583–613. DOI: 10.1201/9780203908426.ch29
growth and development. Botanica Acta 110:265–273.
Rao IM. 2014. Advances in improving adaptation of common
DOI: 10.1111/j.1438-8677.1997.tb00639.x
bean and Brachiaria forage grasses to abiotic stresses in the
Marschner P; Crowley D; Rengel Z. 2011. Rhizosphere
tropics. In: Pessarakli M, ed. Handbook of plant and crop
interactions between microorganisms and plant govern iron
physiology. 3rd Edn. CRC Press, Boca Raton, FL, USA. p.
and phosphorus acquisition along the root axis – model and
847–890. DOI: 10.1201/b16675-49
research methods. Soil Biology and Biochemistry 43:883–
Rao IM; Borrero V; Ricaurte J; García R; Ayarza MA. 1996.
894. DOI: 10.1016/j.soilbio.2011.01.005
Adaptive attributes of tropical forage species to acid soils.
Miles JW; Valle CB; Rao IM; Euclides VPB. 2004.
II. Differences in shoot and root growth responses to varying
Brachiariagrasses. In: Moser L; Burson B; Sollenberger LE,
phosphorus supply and soil type. Journal of Plant Nutrition
eds. Warm-season (C4) grasses. ASA-CSSA-SSSA,
19:323–352. DOI: 10.1080/01904169609365125
Madison, WI, USA. p. 745–783. DOI: 10.2134/agronmono
Rao IM; Miles JW; Granobles JC. 1998. Differences in
tolerance to infertile acid soil stress among germplasm
Nagel OW; Lambers H. 2002. Changes in the acquisition and
accessions and genetic recombinants of the tropical forage
partitioning of carbon and nitrogen in the gibberellin-
grass genus, Brachiaria. Field Crops Research 59:43–52.
deficient mutants A70 and W335 of tomato ( Solanum
DOI: 10.1016/s0378-4290(98)00106-3
lycopersicum L.). Plant, Cell & Environment 25:883–891.
Richardson AE; George TS; Hens M; Simpson RJ. 2005.
DOI: 10.1046/j.1365-3040.2002.00871.x
Utilization of soil organic phosphorus by higher plants. In:
Nanamori M; Shinano J; Wasaki T; Yamamura T; Rao IM;
Turner BL; Frossard E; Baldwin D, eds. Organic
Osaki M. 2004. Low phosphorus tolerance mechanisms:
phosphorus in the environment. CABI Publishing,
Phosphorus recycling and photosynthate partitioning in the
Wallingford, UK. p. 165–184. DOI: 10.1079/9780851998
tropical forage grass, Brachiaria hybrid cultivar Mulato
compared with rice. Plant and Cell Physiology 45:460–469.
Ryan PR; Delhaize E; Jones DL. 2001. Function and mechanisms
of organic anion exudation from plant roots. Annual Review
Neumann G; Römheld V. 2000. The release of root exudates as
of Plant Physiology and Plant Molecular Biology 52:527–
influenced by plant physiological status. In: Pinton R;
560. DOI: 10.1146/annurev.arplant.52.1.527
Varinini Z; Nannipieri P, eds. The rhizosphere:
Sas L; Tang C; Rengel Z. 2001. Suitability of hydroxyapatite
Biochemistry and organic substances at the soil-plant
and iron phosphate as P sources for Lupinus albus grown in
interface . Marcel Dekker Inc., New York, USA. p. 41–93.
nutrient solution. Plant and Soil 235:159–166. DOI:
Neumann G; Römheld V. 2007. The release of root exudates as
influenced by plant physiological status. In: Pinton R;
Sas L; Rengel Z; Tang C. 2002. The effect of nitrogen nutrition
Varinini Z; Nannipieri P, eds. The rhizosphere:
on cluster root formation and proton extrusion by Lupinus
Biochemistry and organic substances at the soil-plant
albus. Annals of Botany 89:435–442. DOI: 10.1093/aob/
interface. 2nd Edn. CRC Press, Boca Raton, FL, USA. p.
23–72. DOI: 10.1201/9781420005585.ch2
Shen H; Wang X; Shi W; Cao Z; Yan X. 2001. Isolation and
Neumann G; Römheld V. 2012. Rhizosphere chemistry in
identification of specific root exudates in elephantgrass in
relation to plant nutrition. In: Marschner P, ed. Marschner’s
response to mobilization of iron- and aluminum-phosphates.
Mineral nutrition of higher plants. Academic Press Elsevier
Journal of Plant Nutrition 24:1117–1130. DOI: 10.1081/
Ltd., New York, USA. p. 347–368. DOI: 10.1016/b978-0-
Ström L; Owen AG; Godbold DL; Jones DL. 2002. Organic
Palomo L; Claassen N; Jones DL. 2006. Differential
acid mediated P mobilization in the rhizosphere and uptake
mobilization of P in the maize rhizosphere by citric acid and
by maize roots. Soil Biology and Biochemistry 34:701–710.
potassium citrate. Soil Biology and Biochemistry 38:683–
DOI: 10.1016/s0038-0717(01)00235-8
692. DOI: 10.1016/j.soilbio.2005.06.019
Tanaka H; Adachi N; Isoi T. 1995. Secretion of formate in
Playsted CWS; Johnston ME; Ramage CM; Edwards DG;
phosphorus-deficient nutrient solution from peanut seedlings
Cawthray GR; Lambers H. 2006. Functional significance of
( Arachis hypogaea L.). Soil Science and Plant Nutrition
dauciform roots: exudation of carboxylates and acid
41:389–392. DOI: 10.1080/00380768.1995.10419599
Tropical Grasslands-Forrajes Tropicales (ISSN: 2346-3775)
116 A.E. Louw-Gaume, N. Schweizer, I.M. Rao, A.J. Gaume and E. Frossard
Tyler G; Ström L. 1995. Differing organic acid exudation pattern
phosphorus starvation in three tropical forages. Journal of
explains calcifuge and acidifuge behaviour of plants. Annals
Plant Nutrition 29:1243–1255. DOI: 10.1080/01904160600
of Botany 75:75–78. DOI: 10.1016/s0305-7364(05)80011-3
Ueno O; Yoshimura Y; Sentoku N. 2005. Variation in the
Wenzl P; Patiño GM; Chaves AL; Mayer JE; Rao IM. 2001.
activity of some enzymes of photorespiratory metabolism in
The high level of aluminum resistance in signalgrass is not
C4 grasses. Annals of Botany 96:863–869. DOI:
associated with known mechanisms of external aluminum
detoxification in root apices. Plant Physiology 125:1473–
Vance CP; Uhde-Stone C; Allan DL. 2003. Phosphorus
1484. DOI: 10.1104/pp.125.3.1473
acquisition and use: Critical adaptations by plants for
Wenzl P; Mancilla LI; Mayer JE; Albert R; Rao IM. 2003.
securing a nonrenewable resource. New Phytologist
Simulating infertile acid soils with nutrient solutions. Soil
157:423–447. DOI: 10.1046/j.1469-8137.2003.00695.x
Science Society of America Journal 67:1457–1469. DOI:
Veneklaas EJ; Stevens J; Cawthray GR; Turner S; Grigg AM;
Lambers H. 2003. Chickpea and white lupin rhizosphere
White DS; Peters M; Horne P. 2013. Global impacts from
carboxylates vary with soil properties and enhance
improved tropical forages: A meta-analysis revealing
phosphorus uptake. Plant and Soil 248:187–197. DOI:
overlooked benefits and costs, evolving values and new
priorities. Tropical Grasslands-Forrajes Tropicales 1:12–24.
Veneklaas EJ; Lambers H; Bragg J; Finnegan PM; Lovelock
CE; Plaxton WC; Price CA; Scheible W-R; Shane MW;
Zhu Y; Yan F; Zörb C; Schubers S. 2005. A link between citrate
White PJ; Raven JA. 2012. Opportunities for improving
and proton release by proteoid roots of white lupin ( Lupinus
phosphorus-use efficiency in crop plants. New Phytologist
albus L.) grown under phosphorus-deficient conditions?
195:306–320. DOI: 10.1111/j.1469-8137.2012.04190.x
Plant and Cell Physiology 46:892–901. DOI: 10.1093/pcp/
Warembourg FR; Roumet C; Lafont F. 2003. Differences in
rhizosphere carbon-partitioning among plant species of
Zindler-Frank E; Hönow R; Hesse A. 2001. Calcium and
different families. Plant and Soil 256:347–357. DOI:
oxalate content of the leaves of Phaseolus vulgaris at
different calcium supply in relation to calcium oxalate
Watanabe T; Osaki M; Yano H; Rao IM. 2006. Internal
crystal formation. Journal of Plant Physiology 158:139–
mechanisms of plant adaptation to aluminum toxicity and
144. DOI: 10.1078/0176-1617-00045
(Received for publication 20 June 2016; accepted 17 August 2017; published 30 September 2017)
© 2017
Tropical Grasslands-Forrajes Tropicales is an open-access journal published by Centro Internacional de Agricultura
Tropical (CIAT). This work is licensed under the Creative Commons Attribution-NonCommercial-ShareAlike 3.0
Unported license. To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-sa/3.0/
Tropical Grasslands-Forrajes Tropicales (ISSN: 2346-3775)
Tropical Grasslands-Forrajes Tropicales (2017) Vol. 5(3):117–128 117
Research Paper
Effect of pollination mode on progeny of Panicum coloratum var.
makarikariense: Implications for conservation and breeding
Efecto del modo de polinización sobre la progenie de Panicum coloratum
var. makarikariense : Implicaciones para conservación y fitomejoramiento
LORENA V. ARMANDO1,2, MARÍA A. TOMÁS1, ANTONIO F. GARAYALDE2,3 AND ALICIA D. CARRERA4
1 Instituto Nacional de Tecnología Agropecuaria (INTA), EEA Rafaela, Santa Fe, Argentina. www.inta.gob.ar
2 Centro de Recursos Naturales Renovables de la Zona Semiarida, CERZOS-CCT-CONICET, Bahía Blanca, Buenos
Aires, Argentina. www.cerzos-conicet.gob.ar
3 Departamento de Matemática, Universidad Nacional del Sur, Bahía Blanca, Buenos Aires, Argentina.
4 Departamento de Agronomía, Universidad Nacional del Sur, Bahía Blanca, Buenos Aires, Argentina.
www.uns.edu.ar/deptos/agronomia
Abstract
Panicum coloratum var. makarikariense, a perennial grass native to Africa, is adapted to a wide range of soil and climatic conditions with potential to be used as forage in tropical and semi-arid regions around the world. Our objective was to
understand how the pollination mode affects viable seed production and further survival of the progeny. We evaluated
self- and open-pollinated progenies from different accessions by measuring the seed production of the parents and their
germination performance, germination rate and seedling survival. Parents and progeny were also fingerprinted with
Simple Sequence Repeats (SSR). Progeny produced through open-pollination resulted in significantly more filled seeds
and superior seedling survival than self-pollination. These results indicate that accessions studied here rely heavily on
cross-pollination, whereas the contribution of self-pollinated offspring to the population is likely to be low. SSR profiles
showed that, on average, 85% of the progeny (arising from cross-pollination) possessed paternal specific markers and
100% of them were genetically different from the maternal genotype. All plants examined had 4x = 36 chromosomes.
Overall, our findings indicate that var. makarikariense is able to generate highly polymorphic progeny through
segregation and recombination. This study provides reference information for the formulation of appropriate strategies
for pasture germplasm management, conservation and development of breeding programs.
Keywords : Breeding systems, pollination, genetic variation, germination, polyploidy, seed production.
Resumen
Panicum coloratum var. makarikariense es una gramínea perenne nativa de África. Se adapta a un amplio rango de ambientes y posee uso potencial como forraje en distintas regiones tropicales y semiáridas del mundo. El estudio tuvo
como objetivo evaluar el efecto del modo de polinización sobre la producción de semilla viable y la supervivencia de la
progenie. Se evaluaron progenies de autopolinización y de polinización cruzada en diferentes accesiones midiendo la
producción de semillas, germinación, tasa de germinación y supervivencia de plántulas, y se obtuvieron perfiles
moleculares con Secuencias Simples Repetidas (SSR). La progenie obtenida mediante polinización cruzada mostró
___________
Correspondence: L. Armando, Instituto Nacional de Tecnología
Agropecuaria, INTA-EEA, 2300 Rafaela, Santa Fe, Argentina.
E-mail: larmando@criba.edu.ar.
Tropical Grasslands-Forrajes Tropicales (ISSN: 2346-3775)
118 L.V. Armando, M.A. Tomás, A.F. Garayalde and A.D. Carrera
significativamente mayor producción de semillas llenas y supervivencia de plántulas que la de autopolinización. Esto
indica que las accesiones evaluadas dependen en gran medida de la alogamia y que la contribución de la descendencia
por autofertilización a la población sería escasa. Los perfiles moleculares SSR mostraron que, en promedio, 85% de la
progenie (obtenida a partir de polinización cruzada) presentó marcadores específicos paternos y 100% de ella difirió del
genotipo materno. Todas las plantas examinadas presentaron 4x = 36 cromosomas. En conjunto, los resultados indican
que la var. makarikariense puede generar progenie altamente polimórfica a través de la segregación y recombinación.
Este estudio provee información útil para el diseño de estrategias de conservación, manejo del germoplasma y programas
de mejoramiento.
Palabras clave : Germinación, polinización, poliploidía, producción de semilla, sistema de reproducción, variación genética.
Introduction
their evolutionary potential. This information is critical
when planning and developing conservation and breeding
The amount of genetic variability within a species and,
programs.
therefore, adaptability of their progeny to the environ-
Panicum coloratum L., a perennial grass native to
ment, are mostly determined by the breeding system.
Africa, is adapted to a wide range of soil and climatic
Autogamous and asexual species produce populations
conditions, and has been used as forage in Australia,
with little evolutionary flexibility and high local
Japan, USA, Mexico and South America (Cook et al.
specialization (Stebbins 1950), whereas outcrossing
2005). This species has been classified into mainly 2
species produce more genetically diverse and ecologically
botanical varieties, var. makarikariense Gooss. and var.
variable offspring. Grasses display an extraordinary
coloratum, distinguished by morphological traits and
diversity of breeding systems including outcrossing,
environmental preferences (Bogdan 1977; Armando et al.
selfing or mixed-breeding, and a mixture of asexual and
2013). The var. makarikariense is particularly well
sexual reproduction (Quinn 1998). Many plant species
adapted to heavy clay soils that fluctuate between drought
have developed different ecological, morphological and
and waterlogged conditions, whereas var. coloratum
physiological mechanisms that reduce the degree of self-
develops well in sandy soils, is tolerant of salinity and
fertilization to promote cross-pollination (Eckert 1994),
performs well at higher latitudes or elevations, as it
most likely motivated by the increase in individual and
thrives under low temperatures, withstanding some frost
(Tischler and Ocumpaugh 2004). In Argentina, a breeding
average population fitness caused by heterosis.
program
and
research
activities involving
var.
The frequency of outcrossing is an important deter-
makarikariense were initiated by the National Institute of
minant of population genetic structure, affecting both
Agricultural Technology (INTA) in 2006, with the
genetic diversity within populations and genetic
purpose of developing new pasture cultivars adapted to
differentiation among them (Barrett and Harder 1996).
marginal (drought, waterlogging, salinity or thermal
Methods commonly employed for assessing the mode of
stress) and less productive environments where livestock
reproduction in forage grasses include cytological and
production has been displaced, with expansion of
embryological analyses of the mother plant and screening
cropping into the most productive paddocks and planting
for morphologically aberrant progeny. Molecular marker
of soybeans.
analysis, in particular, Simple Sequence Repeat (SSR) or
Panicum coloratum botanical varieties have been
microsatellite, is a tool now widely used in a variety of
described as mainly allogamous (Brown and Emery 1958;
fundamental and applied fields of biology, including the
Hutchison and Bashaw 1964), although the degree of self-
identification of selfed, outcrossed or apomictic progeny
fertilization has not been quantified and apomictic
in several grass species (Chistiakov et al. 2006; Liu and
mechanisms have been suggested (Hutchison and Bashaw
Wu 2012). SSRs are loci ubiquitously distributed within
1964). Unlike previous reports, which focused on the
genomes that show a high level of polymorphism,
female parts of flowers and embryo sac development, our
environmental independence and rapid detection pro-
main interest is the analysis of the particular effects of
tocols. The reproductive system and the ploidy level of a
different pollination systems on viable seed production
species determine the transmission of genes across
and the survival of subsequent progeny. In addition,
generations, the pattern of inheritance and gene flow, and
cytogenetic studies in var. makarikariense showed
influence the genetic structure of plant populations and
variable numbers of chromosomes: 2n = 18, 36, 45, 49
Tropical Grasslands-Forrajes Tropicales (ISSN: 2346-3775)
Pollination mode and progeny of Panicum coloratum 119
and 63 (Hutchison and Bashaw 1964; Pritchard and De
sion were placed at 0.6 m intervals in an 8 × 4 matrix plot,
Lacy 1974).
with plots 15 m apart, while the 15 IFF genotypes were
In the present work, progeny of P. coloratum var.
clonally propagated 8 times and arranged linearly in an
makarikariense derived from self- and open-pollinated
8 × 15 matrix plot at a distance of 0.6 m.
panicles were studied through the stages of seed
production, germination and progeny survival. Addi-
Seed production
tional data were obtained from SSR marker analysis,
and chromosome number was also determined. This
Seed production of 3 plants (only 2 plants for accession
study attempted to provide information regarding
DF), selected at random from each of the UCB, MR, BR,
the reproductive behavior of P. coloratum var.
ER and CM accessions and 1 clone of each of the 15 IFF
makarikariense, with utility for conservation and
genotypes (Table 1) (a total of 32 plants) of P. coloratum
breeding.
var. makarikariense, was measured in the field from
March to May 2009. Unfortunately, 1 plant of the DF
Materials and Methods
accession was damaged and data were unavailable. For
each plant, 2 panicles were selected at random: 1 for self-
Plant samples
pollination and 1 for open-pollination. Only a single
panicle was enclosed in each seed trap, the ones for self-
Panicum coloratum was introduced into Argentina in the
pollination before anthesis and the ones for outcrossing
1990s but has not been used widely as forage, although it
when 2/3 of the panicle was in anthesis. Seed traps were
has been conserved at various locations as collections or
used in order to facilitate seed collection and to prevent
in small paddocks. Details of introductions are often
losses by seed shattering. Traps were therefore put in
limited, with many coming from different parts of the
place at different stages of development for self- and
world. A collection of P. coloratum var. makarikariense
open-pollinated treatments, but within the same treat-
(Table 1) was established in a common garden at the
ment attempts were made to select panicles at the same
INTA Rafaela Experiment Station (31°11'41'' S,
stage of development. In self-pollinated treatments seed
61°29'55'' W) in Argentina in 2006, as a breeding popu-
traps were covered with a white cotton bag to prevent
lation. Pre-breeding studies demonstrated a high level of
pollen arrival from other sources without precluding light
variability in morphological and molecular markers, both
interception and photosynthesis of glumes (Figure 1).
among and within accessions, which justified the
Self- and open-pollinated seeds were collected simulta-
initiation of a breeding program (Armando et al. 2013). In
neously once a week and manually separated from the
fact, a cultivar from the program was released recently:
glumes and other residuals. Eventually, the total number
Kapivera INTA (Giordano et al. 2013). The collection
of seeds per inflorescence was counted, i.e. dark brown
comprised 6 accessions of 32 plants each and 15 clonally
seeds (comprising lemma and palea containing a
propagated genotypes (IFF) obtained by selection on
caryopsis). Small light-weight whitish seeds (hereafter
agronomic characteristics. The 32 plants of each acces-
referred to as “empty seeds”) were also produced and
Table 1. Accessions of P. coloratum var. makarikariense and their collection site description.
Accession code
Description
Site of preservation
Coordinates
Province
DF
Twelve-year-old pasture
Dean Funes (150 km Northwest
30°26' S, 64°21' W
Córdoba
Under heavy cattle grazing
from Córdoba city)
UCB
Ungrazed pasture
Catholic University of Córdoba;
31°25' S, 64°11' W
Córdoba
collected in South Africa
MR
Ungrazed pasture
Catholic University of Córdoba;
31°25' S, 64°11' W
Córdoba
collected in South Africa
BR
Ten-year-old pasture under cattle
Mercedes Experiment Station
29°11′ S, 58°02′ W
Corrientes
grazing
(INTA); introduced from Brazil
ER
Five-year-old pasture under cattle
Private farm near Mercedes
29°03' S, 57°49' W
Corrientes
grazing
IFF 1‒15
Clonal materials
CIAP-INTA Institute of Physiology
31°24' S, 61°11' W
Córdoba
and Plant Genetic Resources
CM
Seeds commercially distributed by a cv. ‘Bambatsi’; imported from
-
private company
Australia
Tropical Grasslands-Forrajes Tropicales (ISSN: 2346-3775)
120 L.V. Armando, M.A. Tomás, A.F. Garayalde and A.D. Carrera
counted as immature florets and/or spikelets with pre-
the initiation of the germination trial. Studies by Tomás et
mature shattering from the inflorescences. Empty seeds
al. (2015) showed that maximum germination has been
show poor germination capacity, while dark brown seeds
reached by day 7. A seed was considered germinated
show a high germination percentage (Maina et al. 2017).
when the radicle emerged through the seed coat. Eight-
The final numbers of seeds produced under self- and
day-old seedlings were individually transplanted into 0.5
open-pollinated conditions were compared.
L plastic containers filled with a soil-sand-perlite mix
(1:1:1 v/v), placed in a greenhouse at 28 °C and watered
as needed, usually every 2 to 3 days. Seedling survival
percentage (% Ss) was recorded when seedlings were 15
and 40 days old.
Progeny test
In order to analyze genetic composition of the offspring,
a random sample of 12‒15 seedling descendants from 3
female parents, UCB3, ER1 and IFF10, was genetically
characterized. These plants were selected to represent
the observed range in the number of seeds produced
within var. makarikariense (see Figure 2). Progeny test
was performed only on seeds produced via open
pollination as only a limited number of progeny were
Figure 1. Seed traps enclosing inflorescences consisting of an
obtained from selfing. In addition, progeny obtained from
iron cylindrical structure covered by a nylon stocking (modified
open-pollinated traps resembled more natural pollination
from Young 1986). a) Open-pollination trap (left) and self-
conditions.
pollination trap with a white cloth bag (right). b) Detail of the
DNA extraction was carried out using a modified SDS
lower part of the trap (water drainage). Seeds (= mature florets)
method (Edwards et al. 1991). Approximately 150 mg of
were trapped and funneled into a cap as they shattered from the
leaf tissue (from plants >1 year old) was homogenized in
panicle.
liquid nitrogen. A 700 μL volume of extraction buffer
containing: 50 mM Tris pH 8, 10 mM EDTA pH 8,
Seed germination and seedling survival
100 mM NaCl, 10 mM 𝛽-mercaptoethanol and 10% SDS,
was added and incubated at 65 °C for 20 min. After
Harvested seeds were naturally air-dried and stored at
adding 200 μL of 5 M potassium acetate pH 4.8, the
room temperature in paper bags for 1 year before testing
sample was incubated on ice for at least 20 min and then
for seed germination to ensure dormancy was already
centrifuged at 13,000 rpm for 20 min. This was followed
overcome (Tischler and Young 1987). Of the 32 plants
by precipitation with 700 μL of iso-propanol incubated
evaluated, only 11 produced filled seeds under self-
at -20 °C for 10 min, and centrifugation at 13,000 rpm for
pollination. In each accession, only plants producing a
4 min. The resulting pellet was washed with ethanol 70%
good quantity of filled seeds (UCB3, MR1, BR1, ER1,
and dissolved in 100 μL of 1 x TE buffer. DNA quality
CM2, IFF10; see Figure 2) were used to evaluate
germination and seedling survival (n = 6). Thirty filled
was evaluated in agarose gel and the quantity was
seeds per panicle from the same plants in both self- and
determined by spectrophotometry.
open-pollinated treatments were placed in 10-cm
In previous work, out of 40 heterologous SSR loci
diameter Petri dishes separately with filter paper at the
evaluated in P. coloratum var. makarikariense, 10 primer
bottom moistened with distilled water, and incubated in a
pairs were successfully amplified showing polymorphic
programmed germination chamber at 42% humidity and
and clear banding patterns (Armando et al. 2015). From
27 °C (Tomás et al. 2015) at a 16-hour photoperiod (light
these, the 5 most variable ones were chosen for analysis
photon flux density: 48 mmol/s/m2). Dishes from
both of mother plants and offspring (Table 2).
different pollination treatments and different plants were
Amplification reactions were performed in 20 μL final
randomly arranged in the chamber. The number of
volume containing: 30 ng of DNA template, 2.5 mM
germinated seeds per dish was counted daily and seed
MgCl2, 0.125 mM of each dNTPs, 10 pmol of each primer
germination percentage (% G) was recorded on day 7 after
and 1 U of Taq DNA polymerase in 1.6x buffer. Negative
Tropical Grasslands-Forrajes Tropicales (ISSN: 2346-3775)
Pollination mode and progeny of Panicum coloratum 121
Table 2. Simple sequence repeat (SSR) loci used for progeny analysis and polymerase chain reactions (PCR) conditions.
Repeat motif
Source
Sequence (5´ 3´)
TD/Tm
1- (AG)8T(AG)7
EST- Panicum maximum
F: TGTATGAGCTGAGTCGC
63–53/58
R: TGGTAATCTAGTTGATATTC
2- (AG)8
