This issue is dedicated to the memory of Ronald (Ron) J. Williams (1930-2017), Australian

plant geographer and pasture scientist, a pioneer in tropical forage plant collection,

introduction and evaluation. His friends and colleagues throughout the tropical world will

not forget him for his remarkable personality and intimate knowledge, vision and enthusiasm

for tropical forage plant genetic resources.

International Center for Tropical Agriculture (CIAT) retains copyright of articles with the work simultaneously licensed under the Creative Commons − Attribution-NonCommercial-ShareAlike 3.0 Unported license (to view a copy of this license, visit

http://creativecommons.org/licenses/by-nc-sa/3.0/).

Accordingly, users/readers are free to share (to copy, distribute and transmit) and to remix (to adapt) the work under the conditions of Attribution, Noncommercial, and Share Alike (see http://creativecommons.org/licenses/by-nc-sa/3.0/).

Editors

Rainer Schultze-Kraft,

Lyle Winks,

Centro Internacional de Agricultura Tropical (CIAT),

Former editor of “Tropical Grasslands”,

Colombia

Australia

Management Committee

Changjun Bai,

Rainer Schultze-Kraft,

Chinese Academy of Tropical Agricultural Sciences

Centro Internacional de Agricultura Tropical (CIAT),

(CATAS),

Colombia

P.R. China

Cacilda B. do Valle,

Robert J. Clements,

Empresa Brasileira de Pesquisa Agropecuária (Embrapa),

Agricultural Consultant,

Brazil

Australia

Lyle Winks,

Asamoah Larbi,

Former editor of “Tropical Grasslands”,

International Institute of Tropical Agriculture (IITA),

Australia

Nigeria

Michael Peters,

Centro Internacional de Agricultura Tropical (CIAT),

Colombia

Editorial Board

Changjun Bai,

Albrecht Glatzle,

Chinese Academy of Tropical Agricultural Sciences

Iniciativa para la Investigación y Transferencia de

(CATAS),

Tecnología Agraria Sostenible (INTTAS),

P.R. China

Paraguay

Caterina Batello,

Orlando Guenni,

Food and Agriculture Organization of the United Nations

Universidad Central de Venezuela (UCV),

(FAO),

Venezuela

Italy

Jean Hanson,

International Livestock Research Institute (ILRI),

Michael Blümmel,

Ethiopia

International Livestock Research Institute (ILRI),

India

Michael David Hare,

Ubon Ratchathani University,

Robert J. Clements,

Agricultural Consultant,

Thailand

Australia

Mario Herrero,

Commonwealth Scientific and Industrial Research

Myles Fisher,

Organisation (CSIRO),

Centro Internacional de Agricultura Tropical (CIAT),

Australia

Colombia

Masahiko Hirata,

Bruce Pengelly,

University of Miyazaki,

Agricultural Consultant,

Japan

Australia

Peter Horne,

T. Reginald Preston,

Australian Centre for International Agricultural Research

University of Tropical Agriculture Foundation (UTA),

(ACIAR),

Colombia

Australia

Johann Huguenin,

Kenneth Quesenberry,

Centre de Coopération Internationale en Recherche

University of Florida,

Agronomique pour le Développement (CIRAD),

USA

France

Max Shelton,

Muhammad Ibrahim,

University of Queensland,

Centro Agronómico Tropical de Investigación y Enseñanza

Australia

(CATIE),

Costa Rica

Werner Stür,

Australian Centre for International Agricultural Research

Asamoah Larbi,

(ACIAR),

International Institute of Tropical Agriculture (IITA),

Australia

Nigeria

Carlos E. Lascano,

Cacilda B. do Valle,

Universidad Nacional de Colombia - Sede Bogotá,

Empresa Brasileira de Pesquisa Agropecuária (Embrapa),

Colombia

Brazil

Robert Paterson,

Agricultural Consultant,

Spain

Principal Contacts

Rainer Schultze-Kraft

Centro Internacional de Agricultura Tropical (CIAT)

Colombia

Phone: +57 2 4450100 Ext. 3036

Email: r.schultzekraft@cgiar.org

Technical Support

José Luis Urrea Benítez

Centro Internacional de Agricultura Tropical (CIAT)

Colombia

Phone: +57 2 4450100 Ext. 3354

Email: CIAT-TGFT-Journal@cgiar.org

Table of Contents

Research Papers

Temporal differences in plant growth and root exudation of two Brachiaria grasses in response to low

103-116

phosphorus supply

Anna E. Louw-Gaume, Noel Schweizer, Idupulapati M. Rao, Alain J. Gaume, Emmanuel Frossard

Effect of pollination mode on progeny of Panicum coloratum var. makarikariense: Implications for

117-128

conservation and breeding

Lorena V. Armando, Maria A. Tomás, Antonio F. Garayalde, Alicia D. Carrera

Screening of salt-tolerance potential of some native forage grasses from the eastern part of Terai-Duar

129-142

grasslands in India

Swarnendu Roy, Usha Chakraborty

Reduction of sward height in the fall and winter as a strategy to improve the structure of marandu

143-152

palisadegrass ( Urochloa brizantha syn. Brachiaria brizantha cv. Marandu)

Manoel E.R. Santos, Miriã G. Simplício, Guilherme P. Silva, Heron A. Oliveira, Ludiêmilem K.P. da

Costa, Diogo O.C. de Sousa

Evaluation and strategies of tolerance to water stress in Paspalum germplasm

153-162

Cristiana de G. Pezzopane, Arthur G. Lima, Pedro G. da Cruz, Tatiane Beloni, Alessandra P. Fávero,

Patrícia M. Santos

Screening of common tropical grass and legume forages in Ethiopia for their nutrient composition and

163-175

methane production profile in vitro

Aberra Melesse, Herbert Steingass, Margit Schollenberger, Markus Rodehutscord

Tropical Grasslands-Forrajes Tropicales (2017) Vol. 5(3):103–116 103

DOI: 10.17138/TGFT(5)103-116

Research Paper

Temporal differences in plant growth and root exudation of two

Brachiaria grasses in response to low phosphorus supply

Diferencias en el crecimiento y exudaciones radiculares de dos especies de

Brachiaria en respuesta a baja disponibilidad de fósforo

ANNA E. LOUW-GAUME1, NOEL SCHWEIZER1, IDUPULAPATI M. RAO2, ALAIN J. GAUME3 AND

EMMANUEL FROSSARD1

1 Group of Plant Nutrition, Institute of Agricultural Sciences, ETH Zurich, Lindau, Switzerland. www.plantnutrition.ethz.ch

2 International Center for Tropical Agriculture (CIAT), Cali, Colombia. www.ciat.cgiar.org

Presently: Plant Polymer Research Unit, National Center for Agricultural Utilization Research, ARS, USDA, Peoria,

IL, USA. www.ars.usda.gov

3 Syngenta Crop Protection, Münchwilen AG, Stein, Switzerland. www.syngenta.com

Abstract

Exploiting the natural variability of Brachiaria forage germplasm to identify forage grasses adapted to infertile acid soils

that contain very low available phosphorus (P) is an important research objective for improving livestock production in

the tropics. The objective of this study was to determine the differences in the release of root biochemical markers, i.e.

carboxylates and acid phosphatases (APases), during the development of P deficiency in signalgrass and ruzigrass. We

used the hydroxyapatite pouch system in hydroponics to simulate conditions of low P supply in acid soils to test the

response of well-adapted signalgrass ( Brachiaria decumbens cv. Basilisk, CIAT 606) and less-adapted ruzigrass

( B. ruziziensis cv. Kennedy, CIAT 654). We monitored shoot and root growth and other physiological and biochemical

components that are important for root functionality at weekly intervals for 3 weeks. We found that monocarboxylate

exudation was not associated with the plant’s physiological P status, while exudation of oxalate and secreted-APases

increased with declining plant P concentrations in both grasses. Ruzigrass showed higher exudation rates and grew faster

than signalgrass, but could not maintain its initial fast growth rate when P concentrations in plant tissue declined to

1.0 mg P/g dry matter. Oxalate was the dominant exuded carboxylate for signalgrass after 21 days of growth and this

response might confer some eco-physiological advantages in signalgrass when grown in low-P acid soils.

Keywords : Acid phosphatases, leaf expansion, oxalate, phosphate uptake and use, root elongation.

Resumen

El aprovechamiento de la variabilidad natural en germoplasma del género Brachiaria para identificar variedades

forrajeras adaptadas a suelos ácidos de baja fertilidad y bajo contenido de fósforo (P) disponible, es un objetivo de investigación importante con el fin de mejorar la producción ganadera en áreas tropicales. En el estudio se evaluaron las

diferencias en la exudación de carboxilatos y fosfatasas ácidas como marcadores bioquímicos radiculares durante el

desarrollo de deficiencia de P en 2 especies de Brachiaria. Para el efecto, se utilizó el sistema hidropónico de bolsas con

___________

Correspondence: Idupulapati M. Rao, Plant Polymer Research Unit,

National Center for Agricultural Utilization Research, Agricultural

Research Service, United States Department of Agriculture, 1815

North University Street, Peoria, IL 61604, USA.

Email: i.rao@cgiar.org; rao.idupulapati@ars.usda.gov

Tropical Grasslands-Forrajes Tropicales (ISSN: 2346-3775)

104 A.E. Louw-Gaume, N. Schweizer, I.M. Rao, A.J. Gaume and E. Frossard

hidroxiapatita para simular condiciones de baja disponibilidad de P en suelos ácidos, con el fin de identificar diferencias entre una gramínea adaptada ( Brachiaria decumbens cv. Basilisk, CIAT 606) y otra menos adaptada ( B. ruziziensis cv.

Kennedy, CIAT 654). Monitoreamos el crecimiento de las partes aéreas y las raíces de las plantas, así como algunos

componentes fisiológicos y bioquímicos importantes para la funcionalidad de las raíces, cada semana en un período de

3 semanas. Los resultados mostraron que la exudación de monocarboxilatos no estaba asociada con el estado fisiológico

de P de la planta, mientras que la exudación de oxalato y fosfatasas ácidas aumentó con la disminución de las

concentraciones de P en ambas gramíneas. Brachiaria ruziziensis mostró tasas de exudación más altas y creció más rápido que B. decumbens; no obstante su tasa de crecimiento rápido inicial se redujo cuando las concentraciones de P en

el tejido vegetal disminuyeron a 1.0 mg/g de materia seca. El oxalato fue el carboxilato exudado prevalente para

B. decumbens después de 21 días de crecimiento, una respuesta que aparentemente confiere algunas ventajas

ecofisiológicas a esta gramínea cuando se cultiva en suelos ácidos de bajo contenido de P disponible.

Palabras clave : Absorción y uso de fósforo, elongación radicular, expansión foliar, fosfatasas ácidas, oxalato.

Introduction

Carboxylates enhance Pi release through the

dissolution of calcium (Ca), iron (Fe) or aluminum (Al)

Adoption of Brachiaria forage grasses over the past 4

phosphates. However, little in vivo evidence for P

decades had a revolutionary impact on livestock produc-

mobilization by carboxylates exists, except that most P-

tivity in the tropics (White et al. 2013). Both signalgrass

deficient plants release higher amounts than P-sufficient

[ Brachiaria (now: Urochloa) decumbens cv. Basilisk,

plants (Ström et al. 2002). The organic acid anions most

CIAT 606] and ruzigrass [ Brachiaria (now: Urochloa)

effective at mobilizing P in soils are, in descending order,

ruziziensis cv. Kennedy, CIAT 654] are grown on infertile

tricarboxylate citrate and the dicarboxylates, oxalate and

acid soils that contain very low available phosphorus (P)

malate (Neumann and Römheld 2000; 2012). Carboxylate

levels, and are used for livestock production in the tropics

release also requires the counter release of a cation to

(Miles et al. 2004).

maintain charge balance. In the case of P deficiency, the

A comparative study by Louw-Gaume et al. (2010a;

rhizosphere pH has been shown to decline concurrently

2010b), using signalgrass and ruzigrass, analyzed the role

with carboxylate release, suggesting a balancing role for

of morphological and physiological responses of roots, as

proton (H+) efflux via H+-ATPases (Hinsinger et al. 2003;

plant mechanistic components to enhance P acquisition

Neumann and Römheld 2012). Two other likely

and P recycling within the plant. More specifically, plants

candidates in terms of counter ions are potassium (K) and

of both grasses grown under low-P conditions had higher

magnesium (Mg). Increased K+ concentrations in root

root biomass fractions and higher root tissue levels of acid

exudates suggest that carboxylate- and K+-effluxes are

phosphatases (APases) and phytases than plants grown

coupled (Ryan et al. 2001), while Zhu et al. (2005)

under high-P conditions. Interestingly, root morpholog-

reported the involvement of Mg2+ in P-limiting

ical traits of signalgrass were not responsive to variation

carboxylate release in white lupin. Benefits for P uptake

in P supply, while lateral root growth in ruzigrass was

resulting from the coupling of carboxylate release to K+-

significantly increased in plants grown at low P supply in

efflux have been shown by Palomo et al. (2006) as

hydroponic growth conditions.

rhizosphere alkalinization by K-citrate-enhanced P

Veneklaas et al. (2003) suggested that the key factor in

mobilization in a high P-fixing acid soil.

plant-soil interactions might be rhizosphere chemistry,

The objective of this study was to determine the

rather than root morphology. Mechanisms to increase

differences in the release of root biochemical markers, i.e.

inorganic P (Pi) availability in the rhizosphere include

carboxylates and APases, during the development of P

carboxylate exudation and APase secretion by plant roots

deficiency in signalgrass and ruzigrass. Our hypothesis

(Gaume et al. 2001; Lambers et al. 2006; Neumann and

was that exudation rates of both biochemical markers of

Römheld 2012). The induction of APases is a general

P deficiency will be augmented in P-deficient plants of

response of plants to Pi starvation and correlations

both grasses, but the 2 grasses could differ qualitatively

between the intracellular and/or extracellular APase

and quantitatively in their response, when grown for a

activity and cellular Pi status have been found (Vance et

short period of 21 days at low P supply. We used the

al. 2003; Nanamori et al. 2004).

hydroxyapatite pouch system in hydroponics (Sas et al.

Tropical Grasslands-Forrajes Tropicales (ISSN: 2346-3775)

Influence of phosphorus deficiency on root exudation 105

2001) to simulate low P supply conditions of infertile

physiological and biochemical responses of both grasses

tropical soils (Louw-Gaume et al. 2010a) and to

to low P supply. Plant responses were monitored at 3 time

investigate whether the release of carboxylates and

intervals, i.e. day 7 (D7), day 14 (D14) and day 21 (D21)

APases from roots is part of a temporally coordinated and

after inducing low P supply to one-week-old seedlings

targeted response to P limitation in signalgrass and

transferred to nutrient solution. This growth period was

ruzigrass. In addition to these physiological responses and

selected to focus on root-level mechanisms for P uptake

associated differences in plasticity, related mechanistic

during vegetative growth.

components such as exuded counter-ions for charge

Phosphate release in control containers (n = 6) without

balance and tissue levels of carboxylates were

plants was monitored and measured as 0.33 ± 0.02 

investigated at weekly intervals for 3 weeks. Finally, as

Pi/d. The mean concentration of Pi on day 0 (day before

responses in leaf and root growth of Brachiaria grasses

introducing seedlings) was 1.00 ± 0.11  (n = 16), a Pi

might differ at low P supply (Rao et al. 1996; Louw-

level that is in agreement with the value of 1  Pi used

Gaume et al. 2010a, 2010b), we also examined these

by Wenzl et al. (2003) to simulate Pi level in soil solutions

morphological responses in order to obtain a whole-plant

of highly weathered acid soils. On a daily basis, the pH

perspective that might contribute to understanding

and Pi concentration of hydroponic solutions were

diversity in plant attributes for tolerance to low-P acid

measured, while the HAP-containing pouch was checked

soils that exists in Brachiaria germplasm (Rao et al. 1998;

daily for potential leakage and visible evidence of

Miles et al. 2004; Rao 2014).

bacterial growth. The complete nutrient solution,

including the pouches, was renewed on days 8 and 15

Materials and Methods

(D8 and D15). As described before (Louw-Gaume et al.

2010a), each hydroponic tank contained 2 replicates of

Plant growth and harvests

each grass and each replicate consisted of 3 plants. The

number of replicates was 10 for each grass (that is, 30

The experimental protocol for the germination of seeds

plants in total). The experiment was repeated and the data

and growth of a tetraploid, apomictic signalgrass

from the second experiment are reported, since this

[ Brachiaria (now: Urochloa) decumbens cv. Basilisk,

experiment included all measurements. Similar results

CIAT 606] and a diploid sexual ruzigrass [ Brachiaria

were observed in both experiments on biomass

(now: Urochloa) ruziziensis cv. Kennedy, CIAT 654] in

production, carboxylate composition and exudation rates

nutrient solution at pH 5.5, using the hydroxyapatite

for both grasses.

(HAP)/dialysis pouch system, was reported by Louw-

Three destructive harvests were performed following

Gaume et al. (2010a). Seeds were surface-sterilized and

the collection of root exudates at D7, D14 and D21,

germinated in the dark (25 °C) for 3 to 4 days on filter

starting at the same time of day for each harvest, as it has

paper saturated with deionized water. Seedlings were

been reported that rhizosphere processes for P

grown for one week in sand culture (with nutrient supply

mobilization exhibit a temporal variability (Neumann and

in mg/kg of sand: 2.6 P, 2.5 N, 3.1 K, 1.0 Ca, 0.38 Mg,

Römheld 2012). The dry matter (DM) per young seedling

0.38 S, 0.02 Zn, 0.03 Cu, 0.001 B, 0.001 Mo) in growth

(n = 10) before inducing low-P treatment was slightly

chambers with a day/night cycle of 12 h at 25 °C and 12

higher for ruzigrass than for signalgrass (37 vs. 32 mg

h at 18 °C, 60% relative humidity and a photon flux

DM). The shoot mass density of signalgrass seedlings was

density of 250 µmol/m2/sec. These conditions for early

higher than for ruzigrass (0.16 vs. 0.13 g DM/g fresh

seedling growth were used since Brachiaria grasses do

biomass). The nutrient concentrations (% of dry weight)

not display rapid early seedling growth level due to their

of the seedlings before low-P treatment were: 0.16 P, 0.19

small seed size. Selected seedlings of each grass with

S, 1.14 N and 44.5 C for the shoot tissue of signalgrass;

similar development were further grown in aerated

and 0.23 P, 0.31 S, 4.29 N and 42.0 C for the shoot tissue

nutrient solution (in mM: 0.25 NH4NO3, 0.53 KNO3, 0.75

of ruzigrass. For root tissue of the seedlings, the

Ca(NO3)2, 0.33 CaCl2, 0.42 MgSO4, 0.17 NaCl, 0.01

concentrations were: 0.07 P, 0.12 S, 1.14 N and 44.5 C in

FeNaEDTA; in µM: 30 H3BO3, 5 ZnSO4, 0.2 CuSO4, 10

signalgrass; and 0.08 P, 0.13 S, 1.36 N and 39.3 C in

MnCl2, 0.1 Na2MoO4) under the same controlled

ruzigrass. Plant material was dried for 4 d at 45 °C before

conditions. The hydroxyapatite/dialysis pouch system in

DM determination. Leaf area was recorded with a leaf

hydroponics was used to induce high-P (5 g of

area meter (Li-COR Model 3100, Lincoln, USA). The

hydroxyapatite) and low-P (1 g of hydroxyapatite) condi-

complete root system was scanned and root length was

tions (Louw-Gaume et al. 2010a). The current study

analyzed using WinRHIZO V3.09b root imaging

included only the low-P treatment to further characterize

software (Regent Inc., Quebec, Canada). The relative

Tropical Grasslands-Forrajes Tropicales (ISSN: 2346-3775)

106 A.E. Louw-Gaume, N. Schweizer, I.M. Rao, A.J. Gaume and E. Frossard

growth rate was calculated for each harvest interval,

AS10 column, in combination with suppressed con-

according to the method of Hoffmann and Poorter (2002).

ductivity, was used and the eluent was 50 m NaOH with

Rates of leaf expansion and root elongation between

a flow rate of 1 ml/min. The exudate samples were dried

harvests were calculated as the change in leaf area (in

and the pellets re-suspended in nanopure water prior to

cm2) or root length (in m) per day for the three 7-day

injection. The identification of carboxylates was

growth periods. For the determination of the plant P, K

confirmed by spiking with standards and carboxylate

and Mg concentrations, dried and milled plant material

release rates were expressed per unit of root length, i.e.

was incinerated at 550 °C, followed by solubilization in

nmol/m/h.

65% HNO3 and analysis with ICP-emission spectroscopy

(Louw-Gaume et al. 2010b).

Effluxes of H+, K+, Mg2+ and NO3‾

Collection of root exudates and pH measurement in CaCl2

At each harvest time, the pH of CaCl2-exudate solutions

traps

increased from 5.5 to values above 6 for both grasses over

the 6-h exudation period. These increases were converted

At each sampling plants were removed from hydroponic

into proton equivalents and expressed as the relative

containers and root systems were washed twice in 0.1 mM

change in protons. Efflux rates of K+ and Mg2+ were

CaCl2 solution (pH 5.5, adjusted with HCl) to eliminate

determined by analyzing the K and Mg concentrations in

possible interference from remaining nutrients close to

the CaCl2 solutions with ICP-emission spectroscopy. The

root systems during the exudation steps. Great care was

CaCl2 solutions were also analyzed for the presence of

taken when handling root systems to avoid tissue damage.

nitrate (NO3‾) using a flow injection analyzer (SKALAR

The first exudation step was performed for 6 h in aerated

San++ System, Netherlands). The relative change in

0.1 mM CaCl2 (pH 5.5) solution containing 0.01% (v/v)

protons and efflux rates of K+, Mg2+ and NO3‾ were

protease inhibitor cocktail (Sigma, P2714) under the same

expressed per unit of root length, i.e. mol protons, K+,

growth chamber conditions as for plant growth. The

Mg2+/m/h and nmol NO

second step was carried out for 1 h at 4 oC in 0.1 mM NaCl

3‾/m/h.

(pH 5.5, adjusted with HCl) with the same inhibitor

Acid phosphatase and phytase activity

cocktail. Exudation volumes were adjusted at each

harvest time to compensate for different plant sizes. For

Acid phosphatase activities detected in the CaCl2 and

example, at D7, the exudation volume was 30 ml per

NaCl solutions were grouped as secreted APases

bunch of 3 plants for both grasses and 80 ml and 110 ml

(sAPases) and cell-wall-associated APases (cwAPases),

for signalgrass and ruzigrass, respectively, at D21. The

respectively. Root exudate solutions were concentrated

pH was measured at the end of the 6-h period in the CaCl2

with centrifugal filters (Amicon Ultra-15, Millipore,

solutions. Exudates were centrifuged at low speed (4 oC)

USA) for the detection of phytase activity. The activities

for 3 min, filtered through 0.2-μm syringe filters and

of acid phosphomonoesterases and phytases were

stored at -80 oC until assayed. These steps were in line

determined as described by Louw-Gaume et al. (2010b).

with recommendations by Gaume et al. (2001) and

Enzyme activities were expressed as enzyme units (U)

Neumann and Römheld (2000).

per unit root length, where 1 U releases 1 mol Pi/min.

Carboxylate extraction and determination

Statistical analysis

The roots were washed with de-ionized water and blotted

dry with paper towels, frozen in liquid nitrogen and stored

The Welch two sample t-test was used to determine

at -80 oC until extraction. The method of Zindler-Frank et

differences between species and between harvest intervals

al. (2001) was slightly modified and soluble oxalate was

(R Core Team 2014).

extracted by grinding frozen leaf and root material in warm

(50 oC) deionized water, followed by heating at 80 oC for

Results

30 min, bench-top centrifugation, filtration through 0.2-μm

syringe filters and acidification with HCl to pH 3‒4. These

Biomass production and plant P concentrations

extracts were also used for the determination of glycolate.

The carboxylates in vacuum-concentrated CaCl2

The total biomass production increased between

solutions were analyzed by ion chromatography (Dionex

sequential harvests for both grasses, but ruzigrass pro-

DX 500 System, Dionex Corporation, USA). An Ion Pac

duced more biomass at each harvest time (Figure 1A).

Tropical Grasslands-Forrajes Tropicales (ISSN: 2346-3775)

Influence of phosphorus deficiency on root exudation 107

Figure 1B shows that ruzigrass could not maintain its

levels were similar for both grasses at subsequent harvests,

relative rate of biomass production after D14 (14 days

reaching about 1.0 mg P/g DM at D21.

after inducing low-P treatment) and the relative growth

rate declined by 30%, to a level similar to that maintained

Carboxylates in root exudates and in tissues

by signalgrass throughout. Rate of leaf expansion in-

creased strongly between D7 and D14, with a smaller

Figure 3A shows exudation rates and composition of

increase in rate from D14 to D21, while rate of root

organic acid anions, i.e. acetate, glycolate, formate, lactate

elongation for ruzigrass was much greater between D14

(monocarboxylates) and oxalate (dicarboxylate). Citrate

and D21 than for the other periods (Figures 1C and 1D,

(tricarboxylate) and malate (dicarboxylate) could not be

respectively). Root diameter was not affected by

detected in the root exudates of either grass. The combined

decreasing plant-P concentrations, although signalgrass

exudation rates of all carboxylates for ruzigrass were 115%

had thinner roots at each harvest time (results not shown).

greater than those for signalgrass at D7, 240% greater at

Plant-P concentrations in both grasses declined with age

D14 and only 55% greater at D21. The temporal patterns

with a greater reduction for ruzigrass than for signalgrass

of monocarboxylate exudation did not differ between

(Figure 2). P concentration in ruzigrass at D7 was much

grasses, with rates decreasing after D7 (Figure 3B), but

greater than for signalgrass (3.8 vs. 2.1 mg/g DM) but

then increasing slightly between D14 and D21. In contrast,

Figure 1. Morphological attributes of signalgrass and ruzigrass at day 7 (D7), day 14 (D14) and day 21 (D21) after inducing low-P

treatment under hydroponic conditions. (A) Total dry biomass (DM). (B) Relative growth rate (mg/mg/d) for each of the 3 harvest intervals, i.e. D0-D7 (first harvest interval), D7-D14 (second harvest interval) and D14-D21 (third harvest interval), where D0 refers to the start of the experiment and the day on which young seedlings were prepared for experimental use. (C) Rate of leaf expansion (cm2/d). (D) Rate of root elongation (m/d). Means for a specific harvest time or harvest interval with different letters indicate significant differences between grasses (P<0.05).

Tropical Grasslands-Forrajes Tropicales (ISSN: 2346-3775)

108 A.E. Louw-Gaume, N. Schweizer, I.M. Rao, A.J. Gaume and E. Frossard

fraction at D7 and D14 was greater for ruzigrass than for

signalgrass (5 and 31% vs. 1 and 17%, respectively). By

D21 the level in signal grass had increased to 45%, while

the level in ruzigrass remained at 31%. Patterns of lactate

exudation were similar in both grasses, being high at both

D7 and D21 with very low levels at D14. At D21

signalgrass had a higher oxalate:lactate ratio than

ruzigrass (1.7 vs. 0.5). For both grasses, the temporal

patterns for glycolate and formate fractions were similar;

absolute levels of exudation did not vary over time as

much as levels of acetate, oxalate and lactate but the

percentages of total exudation fluctuated because of

changes in the other components.

Tissue concentrations of soluble oxalate and glycolate

are shown in Table 1. For each grass, leaf and root oxalate

concentrations did not change between D7 and D14. At

Figure 2. Plant-P concentrations of signalgrass and ruzigrass

these harvest times, signalgrass had greater leaf:root

at day 7 (D7), day 14 (D14) and day 21 (D21), expressed as mg

oxalate ratios than ruzigrass due to oxalate concentrations

P/g DM, after inducing low-P treatment under hydroponic

in signalgrass being higher in leaves and lower in roots

conditions. Vertical bars represent ± s.e. (n = 30).

than those of signalgrass. Leaf oxalate concentrations in

signalgrass decreased after D14, while for ruzigrass, both

patterns of oxalate exudation differed between grasses

leaf and root oxalate concentrations declined. Glycolate

(Figure 3C) with rate increasing throughout for signalgrass

concentrations were up to 30 times those of oxalate in

but peaking at D14 for ruzigrass. Final levels at D21 were

both grasses. In addition, leaf glycolate concentrations

similar for both grasses.

showed moderate temporal variation, with lowest values

The carboxylate composition of root exudates changed

at D14, while root glycolate levels changed in a similar

over time for both grasses (Figure 3A). The oxalate

way to oxalate levels in each grass.

Figure 3. Root exudation rates (nmol/m/h) of carboxylates by signalgrass and ruzigrass at day 7 (D7), day 14 (D14) and day 21 (D21) after inducing low-P treatment under hydroponic conditions. (A) Total root exudation rates and carboxylate composition. Different letters indicate significant differences between grasses for total root exudation rate at a specific harvest. (B) Rates of monocarboxylate root exudation, including acetate, glycolate, formate and lactate. (C) Rates of oxalate root exudation.

Tropical Grasslands-Forrajes Tropicales (ISSN: 2346-3775)

Influence of phosphorus deficiency on root exudation 109

Table 1. Tissue concentrations (nmol/g fresh mass) and leaf:root ratios of oxalate and glycolate for signalgrass and ruzigrass at day 7 (D7), day 14 (D14) and day 21 (D21) after inducing low-P treatment under hydroponic conditions.

Carboxylate

Harvest

Signalgrass

Ruzigrass

Leaf (L)

Root (R)

L:R ratio

Leaf (L)

Root (R)

L:R ratio

Oxalate

D7a

53a1

17a

3.1 1

44b

22b

2.01

D14a

61a

16a

3.8 1

45b

27b

1.71

D21a

39a

18a

2.2 1

33a

13b

2.51

Glycolate

D7a

1,379a

415a

3.3 1

1,354a

646b

2.11

D14a

960a

471a

2.0 1

1,215b

814b

1.51

D21a

1,364a

448a

3.0 1

1,601a

329b

4.91

1Within rows and plant parts, values followed by different letters are different (P<0.05).

Changes in proton equivalents and efflux rates of K+,

during this short experimental period of 21 days that

Mg2+and NO3‾ and root concentrations of K and Mg

focused on plant mechanisms and associated plasticity for

P uptake during early vegetative growth. However, the

The relative change in proton equivalents (Figure 4A) was

growth of ruzigrass was compromised during the

greater for signalgrass than for ruzigrass at D7, but

development of P deficiency; while ruzigrass grew very

grasses did not differ at D14 and D21. For both grasses

fast initially, it could not maintain its relative growth rate

the lowest values were recorded at D21 (i.e. pH increased

and strong leaf expansion after D14. In addition, plant-P

to a lesser extent from the value of 5.5 after D14). Rates

concentrations declined after D14 to below 2.0 mg P/g

of efflux of NO3‾ (Figure 4B), K+ (Figure 4C) and Mg2+

DM, indicating that ruzigrass started to economize on Pi.

(Figure 4D) generally increased with time, while root

Veneklaas et al. (2012) suggested that the reduction in

concentrations of K and Mg declined over time (Figures

growth is not a direct consequence of low shoot-P status,

4E and 4F).

but of signaling events that can be genetically controlled.

Lambers et al. (2008) also reported that roots sense that

Temporal patterns of APase secretion and phytase pro-

nutrients such as N and P are limiting well before leaves

portion

experience deficiency symptoms, indicating that shoot

growth is regulated in a feed-forward manner.

Rates of secretion of sAPases were similar in both grasses

Critical shoot-P concentrations in Brachiaria grasses

at D7 and D21, but ruzigrass had a much higher secretion

are around 1.0 mg P/g DM (Rao 2001). For ruzigrass, the

rate at D14 than signalgrass (Figure 5A). For both grasses,

key factor responsible for high P uptake and high initial P

cwAPase release rates increased only after D14, by 2-fold

concentrations might be a faster growth rate as suggested

in signalgrass and 6-fold in ruzigrass (Figure 5B).

by Lambers and Poorter (2004). In contrast, signalgrass

Compared with sAPases at D21, rates of cwAPases were

had lower P uptake and P concentration in tissue initially,

3-fold higher in signalgrass and 10-fold higher in

resulting in lower growth rates. This balanced growth rate

ruzigrass. Extracellular phytases could be detected only at

may ensure that nutrient demand does not exceed its

D21 in both the CaCl2- and NaCl-collections. Phytase

supply.

proportions (as a percentage of the total APase pool) were

low for both grasses, but were slightly higher in the

Release of oxalate and APase are linked to decreasing

cwAPase pool than in the sAPase pool.

plant-P concentrations

Discussion

Our results suggest that oxalate and APases are involved

in the P-nutrition of both Brachiaria grasses as temporal

Low P supply reduced biomass production and leaf

associations between decreases in plant-P concentrations

expansion in ruzigrass

and increases in the exudation of these biochemical

attributes were evident. The release of both components

In agreement with earlier findings (Louw-Gaume et al.

might also form part of a coordinated adaptive strategy

2010a), ruzigrass was a faster-growing grass and

and functional synergy between oxalate and APases,

produced more biomass than signalgrass at low P supply

which could improve acquisition of P in low-P acid soils

Tropical Grasslands-Forrajes Tropicales (ISSN: 2346-3775)

110 A.E. Louw-Gaume, N. Schweizer, I.M. Rao, A.J. Gaume and E. Frossard

Figure 4. Relative change in proton equivalents (mol/m/h) and efflux rates of NO3‾ (nmol/m/h), K+ (mol/m/h) and Mg2+ (mol/m/h) and K and Mg concentrations (mg/g) in roots of signalgrass and ruzigrass at day 7 (D7), day 14 (D14) and day 21 (D21) after inducing

low-P treatment under hydroponic conditions. (A) Change in pH (from pH 5.5) expressed as relative change in proton equivalents. (B) Rate of NO3‾-efflux. (C) Rate of K+-efflux. (D) Rate of Mg2+-efflux. (E) Root K concentrations. (F) Root Mg concentrations.

Figure 5. Root exudation of APases (U/m) by signalgrass and ruzigrass at day 7 (D7), day 14 (D14) and day 21 (D21) after inducing low-P treatment under hydroponic conditions. (A) Rate of secreted APases collected in CaCl2 solution. (B) Rate of cell-wall-associated APases collected in NaCl solution. Activity of extracellular phytase was detected only at D21 and its percentage of the

total pool of APases is indicated in the left upper corner of each graph.

Tropical Grasslands-Forrajes Tropicales (ISSN: 2346-3775)

Influence of phosphorus deficiency on root exudation 111

as carboxylates can enhance the solubility of not only

Acquisition of P from phytate by phytases could

inorganic P, but also organic soil-P forms, which are

potentially provide plants with an alternative organic P

subsequently hydrolyzed by phosphatases (Vance et al .

source (Richardson et al. 2005). Louw-Gaume et al.

2003; Jones et al. 2004; Playsted et al. 2006).

(2010b) reported higher root tissue levels of APases and

The increase in exudation of oxalate and sAPases by

phytases for plants grown under low-P conditions with

roots could be associated with decreases in P

phytase proportions representing less than 1% of the total

concentrations in each grass. These traits increased during

APase pool in root tissue, while the present study found

early growth, together with the first decline in plant-P

higher phytase proportions in both the sAPase and

concentrations in ruzigrass, supporting as well a higher

cwAPase pools (2 and 5%, respectively). Interestingly,

growth demand for P in this grass. While rate of exudation

the grasses we studied did not differ with regard to

of carboxylate and sAPase by ruzigrass peaked at D14,

phytase fractions in either study. Our results are at

secretion of cwAPase increased sharply during the next 7

variance with the findings by Li et al. (1997), who

days, when plant-P concentrations declined further and

reported high levels of phytase secretion in P-deficient

biomass production would have been compromised. It is

B. decumbens plants. The experimental system used in

important to emphasize that, although root exudation

simulating low-P supply conditions in the hydroponics

responses of ruzigrass after D14 appeared to level off,

growth medium might explain these differences. Our

root elongation increased strongly after D14. Thus, if root

results support the observations of Hayes et al. (1999),

growth was stimulated while exudation rates were

who reported that phytase activity constituted only a small

maintained during P-limited growth, the key factor to

component (less than 5%) of the total APase activity in

consider was total below-ground output of carboxylates,

various plants.

which might be higher for ruzigrass. Louw-Gaume et al.

(2010a) also showed that lateral root growth was

Oxalate exudation may enhance P acquisition in acid

stimulated in ruzigrass only when grown at low P supply.

tropical soils

Interestingly, Hütsch et al. (2002) reported that cultivar

differences in total amounts of root-released C could be

Oxalate exudation in response to P deficiency has been

attributed to root length.

reported in sugarbeet (Gerke et al. 2000), soybean (Dong

Furthermore, it appears that root morphological

et al. 2004), rice (Hoffland et al. 2006) and Banksia

plasticity in ruzigrass is associated with a high level of

species (Denton et al. 2007) and our results for both

root physiological plasticity as evident from the strong

Brachiaria grasses are consistent with these observations.

induction of cwAPases by plant P concentrations below 2

Pentanedioic acid and oxalic acid were also dominant

mg P/g DM. This finding also suggests a dependence on a

exuded organic acids in P-deficient elephantgrass

critical threshold of Pi depletion as a signal for enzymatic

( Pennisetum purpureum), another tropical forage grass

cwAPase induction (Jain et al. 2007). In white lupin,

(Shen et al. 2001). Dong et al. (2004) also noted that

secretory APases were produced not only by tap root

exudation of oxalate rather than other carboxylates may

epidermal cells, but also in the cell walls and intercellular

present higher physiological efficiency, as less C and

spaces of lateral roots. Such apoplastic phosphatases are

energy are consumed during exudation.

protected from inactivation by various soil processes, but

Hydroponic experiments provide only indirect

effectiveness depends on the presence of soluble

evidence and the functional significance of carboxylate

organophosphates in soil solution (Neumann and

exudation in a real soil environment remains unknown

Römheld 2007; 2012). Although the enzymatic

(Jones et al. 2004; Neumann and Römheld 2012).

hydrolysis of root-secretory phosphatase is limited by the

Observed exudation rates cannot be compared with those

low solubility of organic P forms in soils (Neumann and

of leguminous plants as their carboxylate effluxes are 10

Römheld 2012), higher phosphatase activities in the

to 50 times higher than for graminaceous species (Gerke

rhizosphere have been reported to contribute to the

et al. 2000). In soils with low P-availability, competition

depletion of organic P from Oxisols containing very low

by carboxylates for P-sorption sites might be of greater

available P (George et al. 2006). In signalgrass, exudation

significance than P-desorption mechanisms, which

responses of all 3 biochemical markers for P limitation,

require high concentrations of carboxylates such as citrate

i.e. oxalate and both groups of APases, were temporally

and oxalate. Huguenin-Elie et al. (2003), using a

coordinated and increased only after D14.

modeling approach, showed that low release rates of

Tropical Grasslands-Forrajes Tropicales (ISSN: 2346-3775)

112 A.E. Louw-Gaume, N. Schweizer, I.M. Rao, A.J. Gaume and E. Frossard

citrate could account for 90% of the P uptake of rice

The higher rate of formate exudation in signalgrass

grown under aerobic conditions. Furthermore, average

was also interesting, as Tanaka et al. (1995) suggested that

values integrated over the whole root system can be

formate could solubilize Fe-P forms due to its strong

misleading and may result in erroneous conclusions about

reducing capacity, based on observations of increased

nutrient relationships in the rhizosphere, due to spatial

formate secretion in P-deficient Arachis hypogaea.

variability of exudation along the root axis (Neumann and

Dinkelaker et al. (1995) also proposed that increased

Römheld 2000; 2012).

reductive capacity in roots may be another P-adaptive

Fox and Comerford (1992) suggested that the

response.

cumulative oxalate loading rate contributes to the

Oxalate exudation might be an important strategy for

solubilization of large amounts of P on an annual basis

Al resistance, as Al-toxicity and P-deficiency co-exist in

and this might be relevant for the survival of the grasses

acid soils and both are major constraints for productivity

used in our study. Furthermore, the effectiveness of

of Brachiaria pastures (Miles et al. 2004). Carboxylate

oxalate was shown in both calcareous and acid soils

exudation could not be linked to external Al

treated with monocalcium phosphate and phosphate rock

detoxification in either grass (Wenzl et al. 2001), but a

(Fox and Cromerfold 1992; Ström et al. 2002), suggesting

low-P background might have obscured responses (Liao

that oxalate exudation by signalgrass and ruzigrass might

et al. 2006). Interestingly, phytosiderophore-mediated

have significance for enhanced P-acquisition in acid soils.

iron release from goethite is also enhanced by oxalate

Application of rock phosphates to acid soils has been

(Marschner et al. 2011) and thus, oxalate might also be

suggested (Fardeau and Zapata 2002) and their suitability

important for Fe uptake from iron oxides in both

as P fertilizer for signalgrass has been demonstrated

Brachiaria grasses.

(Lopes et al. 1991). Araújo et al. (2003) also reported

greater importance for the acid-soluble P fraction than for

Are Mg2+ ions involved in charge balance during oxalate

the NaOH-extractable fraction in a pot experiment using

exudation?

B. decumbens. As signalgrass is better adapted to and

more persistent on infertile acid soils that contain very

Our observations reiterate that interpretation of pH

low available P than ruzigrass (Miles et al. 2004; Rao

changes in the rhizosphere should be considered with

2014), signalgrass might have a selective ecophysio-

caution (Hinsinger et al. 2003; Neumann and Römheld

logical advantage over the long term due to the dominance

2012). The greater pH of CaCl2-containing root exudates

of oxalate plus its slower and more balanced growth rate

may be attributed to lower Ca2+ uptake (versus Cl‾)

and associated implications for higher plant carbon (C)

(Hinsinger et al. 2003). In B. dictyoneura Hylander and

use efficiency (Louw-Gaume et al. 2010b). Leaf oxalate

Ae (1999) also reported an increase in the rhizosphere pH

concentrations were also higher for signalgrass,

due to higher amounts of basic cations and proton

consistent with higher oxalate levels reported for slower-

neutralization. However, the pH of nutrient solutions with

growing plants (Libert and Franceschi 1987).

growing plants declined over time and ruzigrass showed

Although lactate appears to be commonly exuded by

greater capacity to lower the pH (observed in pre-

plant species that are adapted to acid soils (Tyler and Ström

experiments), so we adopted the practice of growing both

1995), the finding that lactate was the dominant exuded

grasses in the same hydroponic container to eliminate

carboxylate in ruzigrass at D21 was unexpected, as the

interferences from the addition of KOH that was used for

presence of lactate has also been linked to detoxification

pH control. Proton release has also been linked to

that could be associated with cytoplasmic acidosis

differential cation/anion uptake (Hinsinger et al. 2003),

(Neumann and Römheld 2000). It is possible that, despite

consistent with the report by Logan et al. (2000), who

its high biomass production, high P uptake and high

found that plant-induced acidity by B. humidicola and

exudation rates of biochemical traits important for P-

B. brizantha was not due to low P-availability, but to

mobilization in acid soils, ruzigrass might start to

adequate supply of nutrients for growth.

experience metabolic complications in maintaining cellular

Our study focused on the most likely counter-cation

Pi homeostasis over a longer growth period (Veneklaas et

candidates to accompany carboxylate efflux (Ryan et al.

al. 2012). In addition, C-costs related to exudation (Dilkes

2001; Zhu et al. 2005). Interest in K+-efflux and root-K

et al. 2004) might have been substantial in ruzigrass, as

levels also stems from the finding that the K or sodium

faster-growing grasses deposit more C than species adapted

salt of oxalate is predominantly found in grasses (Jones

to infertile soils (Warembourg et al. 2003).

and Ford 1971). The two grasses did not differ in the

Tropical Grasslands-Forrajes Tropicales (ISSN: 2346-3775)

Influence of phosphorus deficiency on root exudation 113

pattern of K+-efflux, which increased strongly after D7.

Our results support the notion that increased

Marschner et al. (1997) reported that K+ functions in

carboxylate biosynthesis in plants is a physiological

charge

balance,

especially

in

NO3‾-fed

plants,

alteration associated with the preferential root exudation

participating as well in translocation of carboxylates and

of carboxylates with highest efficiency in P mobilization

soluble sugars. Interestingly, an increase in NO3‾-efflux

under conditions of P limitation (Neumann and Römheld

after D14 was observed only in signalgrass, supporting

2007).

higher NO3‾-efflux rates as reported in slow-growing

plants (Nagel and Lambers 2002). Root-K concentrations

Conclusions

decreased for both grasses as reported during P deficiency

in white lupin (Sas et al. 2002) and the Brachiaria hybrid

The experimental approach used in this study highlights

cv. Mulato (Watanabe et al. 2006).

the importance of adopting an eco-physiological

Despite these uncertainties for H+ and K+, Mg2+

perspective to understand developmental, physiological

appears to be a counter-ion for oxalate efflux as its efflux

and biochemical aspects of adaptation to low-P stress in

pattern corresponded well with the release curves of

Brachiaria grasses. Furthermore, a comparison of species

oxalate in both species. Zhu et al. (2005) reported that

differences in adaptation to limiting P supply became

Mg2+ was involved in carboxylate release of white lupin

feasible by studying, simultaneously, temporal responses

during P deficiency. Increases in Mg2+-efflux by roots

of: (i) whole-plant growth together with variations in both

also corresponded in a timely manner with decreases in

root and leaf attributes; and (ii) root-induced changes in

root concentrations of Mg in each grass.

the rhizosphere that determine nutrient availability and

Another consideration is that cation-efflux rates were

influence plant growth. Results from this study indicate

higher than those of carboxylates. Deficiency of P

that growth may be faster for ruzigrass than for

enhances membrane leakiness (Neumann and Römheld

signalgrass during early establishment in low-P soils but

2007), suggesting that the likelihood of higher non-

ruzigrass may demand higher P supply to sustain its

specific efflux during P limitation cannot be excluded.

higher growth rate. Further research is needed on soil-

grown plants of both grasses to characterize changes in

Glycolate might be an oxalate precursor

rhizosphere induced by exudation of organic acids and

phosphatases from roots.

As expected, monocarboxylate exudation could not be

related to the plant-P status in the current study, but our

Acknowledgments

results on monocarboxylate composition and exudation

patterns could have significance for C utilization. Oxalate

Seeds of signalgrass and ruzigrass were provided by the

can be formed from photorespiratory glyoxylate via

International Center for Tropical Agriculture (CIAT),

glycolate, catalyzed by glycolate oxidase (Franceschi and

Cali, Colombia. This project was part of the research

Nakata 2005). In both grasses we used glycolate might

program of the North-South Centre of the Swiss Federal

be an oxalate precursor, as leaf glycolate levels were

Institute of Technology (ETH-Zurich) “Livestock system

significantly higher than those of oxalate and, in addition,

research in support of poor people”. It was jointly funded

leaf oxalate levels decreased after D14, while leaf

by the ETH-Zurich and the Swiss Agency for

glycolate levels increased. Interestingly, Ueno et al.

Development and Cooperation (SDC), Switzerland.

(2005) studied 28 C4 grasses (ruzigrass not included) and

found activity of glycolate oxidase was greatest in

References

B. brizantha and B. decumbens.

While oxalate exudation increased after D14 in

Araújo MSB; Schaefer CER; Sampaio EVSB. 2003. Plant

signalgrass and also ruzigrass (when increases in root

phosphorus availability in latosols and luvisols from

elongation are considered), leaf oxalate concentrations

northeastern semi-arid Brazil. Communications in Soil

decreased for both grasses, suggesting that leaves might

Science and Plant Analysis 34:407–425. DOI: 10.1081/

be the site of oxalate biosynthesis, as reported by Ji and

CSS-120017829

Denton MD; Veneklaas EJ; Lambers H. 2007. Does phenotypic

Peng (2005). Root levels of oxalate and glycolate did not

plasticity in carboxylate exudation differ among rare and

change over time in signalgrass, but both decreased

widespread Banksia species (Proteaceae)? New Phytologist

strongly in P-deficient ruzigrass plants. Carboxylate

173:592–599. DOI: 10.1111/j.1469-8137.2006.01956.x

efflux has been correlated with intracellular root

Dilkes NB; Jones DL; Farrar J. 2004. Temporal dynamics of

concentrations, but Ryan et al. (2001) pointed out that

carbon partitioning and rhizodeposition in wheat. Plant

membrane processes appear to be the key step for efflux.

Physiology 134:706–715. DOI: 10.1104/pp.103.032045

Tropical Grasslands-Forrajes Tropicales (ISSN: 2346-3775)

114 A.E. Louw-Gaume, N. Schweizer, I.M. Rao, A.J. Gaume and E. Frossard

Dinkelaker B; Hengeler C; Marschner H. 1995. Distribution

in soils. Journal of Plant Nutrition and Soil Science

and function of proteoid roots and other root clusters.

165:397–407. DOI: 10.1002/1522-2624(200208)165:4%3C

Botanica Acta 108:183–200. DOI: 10.1111/j.1438-8677.

397::aid-jpln397%3E3.0.co;2-c

1995.tb00850.x

Hylander L; Ae N. 1999. Nutrient distribution around roots of

Dong D; Peng X; Yan X. 2004. Organic acid exudation induced

Brachiaria, maize, sorghum, and upland rice in an andisol.

by phosphorus deficiency and/or aluminium toxicity in two

Soil Science and Plant Nutrition 45:617–626. DOI:

contrasting soybean genotypes. Physiologia Plantarum

10.1080/00380768.1999.10415825

122:190–199. DOI: 10.1111/j.1399-3054.2004.00373.x

Jain A; Vasconcelos MJ; Raghothama KG; Sahi SV. 2007.

Fardeau J-C; Zapata F. 2002. Phosphorus fertility recapi-

Molecular mechanisms of plant adaptation to phosphate

talization of nutrient-depleted tropical acid soils with

deficiency. Plant Breeding Reviews 29:359–419. DOI:

reactive phosphate rock: An assessment using the isotopic

10.1002/9780470168035.ch7

exchange technique. Nutrient Cycling in Agroecosystems

Ji X-M; Peng X-X. 2005. Oxalate accumulation as regulated by

63:69–79. 10.1023/A:1020583804556

nitrogen forms and its relationship to photosynthesis in rice

Fox TR; Comerford ND. 1992. Influence of oxalate loading on

( Oryza sativa L.). Journal of Integrative Plant Biology

phosphorus and aluminum solubility in Spodosols. Soil

47:831–838. DOI: 10.1111/j.1744-7909.2005.00099.x

Science Society of America Journal 56:290–294. DOI:

Jones DL; Hodge A; Kuzyakov Y. 2004. Plant and mycorrhizal

10.2136/sssaj1992.03615995005600010046x

regulation of rhizodeposition. New Phytologist 163:459–

Franceschi VR; Nakata PA. 2005. Calcium oxalate in plants:

480. DOI: 10.1111/j.1469-8137.2004.01130.x

formation and function. Annual Review of Plant Biology

Jones RJ; Ford CW. 1972. Some factors affecting the oxalate

56:41–71. DOI: 10.1146/annurev.arplant.56.032604.144106

content of the tropical grass Setaria sphacelata. Australian

Gaume A; Mächler F; De León C; Narro L; Frossard E. 2001.

Journal of Experimental Agriculture and Animal Husbandry

Low-P tolerance by maize ( Zea mays L.) genotypes:

12:400–406. DOI: 10.1071/ea9720400

Significance of root growth, and organic acids and acid

Lambers H; Poorter H. 2004. Inherent variation in growth rate

phosphatase root exudation. Plant and Soil 228:253–264.

between higher plants: A search for physiological causes and

DOI: 10.1023/A:1004824019289

ecological consequences. Advances in Ecological Research

George TS; Turner BL; Gregory PJ; Cade-Menun BJ;

34:283–362. DOI: 10.1016/S0065-2504(03) 34004-8

Richardson AE. 2006. Depletion of organic phosphorus

Lambers H; Shane MW; Cramer MD; Pearse SJ; Veneklaas EJ.

from Oxisols in relation to phosphatase activities in the

2006. Root structure and function for efficient acquisition of

rhizosphere. European Journal of Soil Science 57:47–57.

phosphorus: Matching morphological and physiological

DOI: 10.1111/j.1365-2389.2006.00767.x

traits.

Annals

of

Botany

98:693–713.

DOI:

Gerke J; Beissner L; Römer W. 2000. The quantitative effect of

10.1093/aob/mcl114

chemical phosphate mobilization by carboxylate anions on

Lambers H; Chapin FS; Pons TL. 2008. Plant physiological

P uptake by a single root. I. The basis concept and

ecology. 2nd Edn . Springer, New York, USA. DOI:

determination of soil parameters. Journal of Plant Nutrition

10.1007/978-0-387-78341-3

and Soil Science 163:207–212. DOI: 10.1002/(sici)1522-

Li M; Osaki M; Rao IM; Tadano T. 1997. Secretion of phytase

2624(200004)163:2%3C207::aid-jpln207%3E3.0.co;2-p

from the roots of several plant species under phosphorus-

Hayes JE; Richardson AE; Simpson RJ. 1999. Phytase and acid

deficient conditions. Plant and Soil 195:161–169. DOI:

phosphatase activities in extracts from roots of temperate

10.1023/A:1004264002524

pasture grass and legume seedlings. Australian Journal of

Liao H; Wan H; Shaff J; Wang X; Yan X; Kochian LV. 2006.

Plant Physiology 26:801–809. DOI: 10.1071/pp99065

Phosphorus and aluminum interactions in soybean in

Hinsinger P; Plassard C; Tang C; Jaillard B. 2003. Origins of

relation to aluminum tolerance. Exudation of specific

root-mediated pH changes in the rhizosphere and their

organic acids from different regions of the intact root

responses to environmental constraints: a review. Plant and

system. Plant Physiology 141:674–684. DOI: 10.1104/

Soil 248:43–59. DOI: 10.1023/a:1022371130939

pp.105.076497

Hoffland E; Wei C; Wissuwa M. 2006. Organic anion

Libert B; Franceschi VR. 1987. Oxalate in crop plants. Journal

exudation by lowland rice ( Oryza sativa L.) at zinc and

of Agriculture and Food Chemistry 35:926–938. DOI:

phosphorus deficiency. Plant and Soil 283:155–162. DOI:

10.1021/jf00078a019

10.1007/s11104-005-3937-1

Logan KAB; Thomas RJ; Raven JA. 2000. Effects of

Hoffmann WA; Poorter H. 2002. Avoiding bias in calculations

ammonium and phosphorus supply on H+ production in gel

of relative growth rate. Annals of Botany 90:37–42. DOI:

by two tropical forage grasses. Journal of Plant Nutrition

10.1093/aob/mcf140

23:41–54. DOI: 10.1080/01904160009381996

Huguenin-Elie O; Kirk GJD; Frossard E. 2003. Phosphorus

Lopes AS; Goedert WJ; Guilherme LRG. 1991. Use of natural

uptake by rice from soil that is flooded, drained or flooded

and modified phosphate rocks on annual, perennial and

then drained. European Journal of Soil Science 54:77–90.

forestry crops in Brazil. Revista de la Facultad de

DOI: 10.1046/j.1365-2389.2002.00489.x

Agronomia (Maracay) 17:67–95.

Hütsch BW; Augustin J; Merbach W. 2002. Plant

Louw-Gaume AE; Rao IM; Gaume AJ; Frossard E. 2010a. A

rhizodeposition – an important source for carbon turnover

comparative study on plant growth and root plasticity

Tropical Grasslands-Forrajes Tropicales (ISSN: 2346-3775)

Influence of phosphorus deficiency on root exudation 115

responses of two Brachiaria forage grasses grown in

phosphatase under phosphorus deficiency in Caustis blake i

nutrient solution at low and high P supply. Plant and Soil

(Cyperaceae). New Phytologist 170:491–500. DOI:

328:155–164. DOI: 10.1007/s11104-009-0093-z

10.1111/j.1469-8137.2006.01697.x

Louw-Gaume AE; Rao IM; Frossard E; Gaume A. 2010b.

R Core Team. 2014. R: A language and environment for

Adaptive strategies of tropical forage grasses to low

statistical computing. R Foundation for Statistical

phosphorus stress: The case of Brachiaria grasses. In:

Computing, Vienna, Austria. www.r-project.org/

Pessarakli M, ed. Handbook of plant and crop stress. 3rd

Rao IM. 2001. Role of physiology in improving crop adaptation

Edn. CRC Press, Boca Raton, FL, USA. p. 1111–1144. DOI:

to abiotic stresses in the tropics: The case of common bean

10.1201/b10329-54

and tropical forages. In: Pessarakli M, ed. Handbook of

Marschner H; Kirkby EA; Engels C. 1997. Importance of

plant and crop physiology. CRC Press, Boca Raton, FL,

cycling and recycling of mineral nutrients within plants for

USA. p. 583–613. DOI: 10.1201/9780203908426.ch29

growth and development. Botanica Acta 110:265–273.

Rao IM. 2014. Advances in improving adaptation of common

DOI: 10.1111/j.1438-8677.1997.tb00639.x

bean and Brachiaria forage grasses to abiotic stresses in the

Marschner P; Crowley D; Rengel Z. 2011. Rhizosphere

tropics. In: Pessarakli M, ed. Handbook of plant and crop

interactions between microorganisms and plant govern iron

physiology. 3rd Edn. CRC Press, Boca Raton, FL, USA. p.

and phosphorus acquisition along the root axis – model and

847–890. DOI: 10.1201/b16675-49

research methods. Soil Biology and Biochemistry 43:883–

Rao IM; Borrero V; Ricaurte J; García R; Ayarza MA. 1996.

894. DOI: 10.1016/j.soilbio.2011.01.005

Adaptive attributes of tropical forage species to acid soils.

Miles JW; Valle CB; Rao IM; Euclides VPB. 2004.

II. Differences in shoot and root growth responses to varying

Brachiariagrasses. In: Moser L; Burson B; Sollenberger LE,

phosphorus supply and soil type. Journal of Plant Nutrition

eds. Warm-season (C4) grasses. ASA-CSSA-SSSA,

19:323–352. DOI: 10.1080/01904169609365125

Madison, WI, USA. p. 745–783. DOI: 10.2134/agronmono

Rao IM; Miles JW; Granobles JC. 1998. Differences in

gr45.c22

tolerance to infertile acid soil stress among germplasm

Nagel OW; Lambers H. 2002. Changes in the acquisition and

accessions and genetic recombinants of the tropical forage

partitioning of carbon and nitrogen in the gibberellin-

grass genus, Brachiaria. Field Crops Research 59:43–52.

deficient mutants A70 and W335 of tomato ( Solanum

DOI: 10.1016/s0378-4290(98)00106-3

lycopersicum L.). Plant, Cell & Environment 25:883–891.

Richardson AE; George TS; Hens M; Simpson RJ. 2005.

DOI: 10.1046/j.1365-3040.2002.00871.x

Utilization of soil organic phosphorus by higher plants. In:

Nanamori M; Shinano J; Wasaki T; Yamamura T; Rao IM;

Turner BL; Frossard E; Baldwin D, eds. Organic

Osaki M. 2004. Low phosphorus tolerance mechanisms:

phosphorus in the environment. CABI Publishing,

Phosphorus recycling and photosynthate partitioning in the

Wallingford, UK. p. 165–184. DOI: 10.1079/9780851998

tropical forage grass, Brachiaria hybrid cultivar Mulato

220.0165

compared with rice. Plant and Cell Physiology 45:460–469.

Ryan PR; Delhaize E; Jones DL. 2001. Function and mechanisms

DOI: 10.1093/pcp/pch056

of organic anion exudation from plant roots. Annual Review

Neumann G; Römheld V. 2000. The release of root exudates as

of Plant Physiology and Plant Molecular Biology 52:527–

influenced by plant physiological status. In: Pinton R;

560. DOI: 10.1146/annurev.arplant.52.1.527

Varinini Z; Nannipieri P, eds. The rhizosphere:

Sas L; Tang C; Rengel Z. 2001. Suitability of hydroxyapatite

Biochemistry and organic substances at the soil-plant

and iron phosphate as P sources for Lupinus albus grown in

interface . Marcel Dekker Inc., New York, USA. p. 41–93.

nutrient solution. Plant and Soil 235:159–166. DOI:

Neumann G; Römheld V. 2007. The release of root exudates as

10.1023/A:1011989922343

influenced by plant physiological status. In: Pinton R;

Sas L; Rengel Z; Tang C. 2002. The effect of nitrogen nutrition

Varinini Z; Nannipieri P, eds. The rhizosphere:

on cluster root formation and proton extrusion by Lupinus

Biochemistry and organic substances at the soil-plant

albus. Annals of Botany 89:435–442. DOI: 10.1093/aob/

interface. 2nd Edn. CRC Press, Boca Raton, FL, USA. p.

mcf066

23–72. DOI: 10.1201/9781420005585.ch2

Shen H; Wang X; Shi W; Cao Z; Yan X. 2001. Isolation and

Neumann G; Römheld V. 2012. Rhizosphere chemistry in

identification of specific root exudates in elephantgrass in

relation to plant nutrition. In: Marschner P, ed. Marschner’s

response to mobilization of iron- and aluminum-phosphates.

Mineral nutrition of higher plants. Academic Press Elsevier

Journal of Plant Nutrition 24:1117–1130. DOI: 10.1081/

Ltd., New York, USA. p. 347–368. DOI: 10.1016/b978-0-

pln-100103807

12-384905-2.00014-5

Ström L; Owen AG; Godbold DL; Jones DL. 2002. Organic

Palomo L; Claassen N; Jones DL. 2006. Differential

acid mediated P mobilization in the rhizosphere and uptake

mobilization of P in the maize rhizosphere by citric acid and

by maize roots. Soil Biology and Biochemistry 34:701–710.

potassium citrate. Soil Biology and Biochemistry 38:683–

DOI: 10.1016/s0038-0717(01)00235-8

692. DOI: 10.1016/j.soilbio.2005.06.019

Tanaka H; Adachi N; Isoi T. 1995. Secretion of formate in

Playsted CWS; Johnston ME; Ramage CM; Edwards DG;

phosphorus-deficient nutrient solution from peanut seedlings

Cawthray GR; Lambers H. 2006. Functional significance of

( Arachis hypogaea L.). Soil Science and Plant Nutrition

dauciform roots: exudation of carboxylates and acid

41:389–392. DOI: 10.1080/00380768.1995.10419599

Tropical Grasslands-Forrajes Tropicales (ISSN: 2346-3775)

116 A.E. Louw-Gaume, N. Schweizer, I.M. Rao, A.J. Gaume and E. Frossard

Tyler G; Ström L. 1995. Differing organic acid exudation pattern

phosphorus starvation in three tropical forages. Journal of

explains calcifuge and acidifuge behaviour of plants. Annals

Plant Nutrition 29:1243–1255. DOI: 10.1080/01904160600

of Botany 75:75–78. DOI: 10.1016/s0305-7364(05)80011-3

767484

Ueno O; Yoshimura Y; Sentoku N. 2005. Variation in the

Wenzl P; Patiño GM; Chaves AL; Mayer JE; Rao IM. 2001.

activity of some enzymes of photorespiratory metabolism in

The high level of aluminum resistance in signalgrass is not

C4 grasses. Annals of Botany 96:863–869. DOI:

associated with known mechanisms of external aluminum

10.1093/aob/mci238

detoxification in root apices. Plant Physiology 125:1473–

Vance CP; Uhde-Stone C; Allan DL. 2003. Phosphorus

1484. DOI: 10.1104/pp.125.3.1473

acquisition and use: Critical adaptations by plants for

Wenzl P; Mancilla LI; Mayer JE; Albert R; Rao IM. 2003.

securing a nonrenewable resource. New Phytologist

Simulating infertile acid soils with nutrient solutions. Soil

157:423–447. DOI: 10.1046/j.1469-8137.2003.00695.x

Science Society of America Journal 67:1457–1469. DOI:

Veneklaas EJ; Stevens J; Cawthray GR; Turner S; Grigg AM;

10.2136/sssaj2003.1457

Lambers H. 2003. Chickpea and white lupin rhizosphere

White DS; Peters M; Horne P. 2013. Global impacts from

carboxylates vary with soil properties and enhance

improved tropical forages: A meta-analysis revealing

phosphorus uptake. Plant and Soil 248:187–197. DOI:

overlooked benefits and costs, evolving values and new

10.1023/a:1022367312851

priorities. Tropical Grasslands-Forrajes Tropicales 1:12–24.

Veneklaas EJ; Lambers H; Bragg J; Finnegan PM; Lovelock

DOI: 10.17138/tgft(1)12-24

CE; Plaxton WC; Price CA; Scheible W-R; Shane MW;

Zhu Y; Yan F; Zörb C; Schubers S. 2005. A link between citrate

White PJ; Raven JA. 2012. Opportunities for improving

and proton release by proteoid roots of white lupin ( Lupinus

phosphorus-use efficiency in crop plants. New Phytologist

albus L.) grown under phosphorus-deficient conditions?

195:306–320. DOI: 10.1111/j.1469-8137.2012.04190.x

Plant and Cell Physiology 46:892–901. DOI: 10.1093/pcp/

Warembourg FR; Roumet C; Lafont F. 2003. Differences in

pci094

rhizosphere carbon-partitioning among plant species of

Zindler-Frank E; Hönow R; Hesse A. 2001. Calcium and

different families. Plant and Soil 256:347–357. DOI:

oxalate content of the leaves of Phaseolus vulgaris at

10.1023/A:1026147622800

different calcium supply in relation to calcium oxalate

Watanabe T; Osaki M; Yano H; Rao IM. 2006. Internal

crystal formation. Journal of Plant Physiology 158:139–

mechanisms of plant adaptation to aluminum toxicity and

144. DOI: 10.1078/0176-1617-00045

(Received for publication 20 June 2016; accepted 17 August 2017; published 30 September 2017)

© 2017

Tropical Grasslands-Forrajes Tropicales is an open-access journal published by Centro Internacional de Agricultura

Tropical (CIAT). This work is licensed under the Creative Commons Attribution-NonCommercial-ShareAlike 3.0

Unported license. To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-sa/3.0/

Tropical Grasslands-Forrajes Tropicales (ISSN: 2346-3775)

Tropical Grasslands-Forrajes Tropicales (2017) Vol. 5(3):117–128 117

DOI: 10.17138/TGFT(5)117-128

Research Paper

Effect of pollination mode on progeny of Panicum coloratum var.

makarikariense: Implications for conservation and breeding

Efecto del modo de polinización sobre la progenie de Panicum coloratum

var. makarikariense : Implicaciones para conservación y fitomejoramiento

LORENA V. ARMANDO1,2, MARÍA A. TOMÁS1, ANTONIO F. GARAYALDE2,3 AND ALICIA D. CARRERA4

1 Instituto Nacional de Tecnología Agropecuaria (INTA), EEA Rafaela, Santa Fe, Argentina. www.inta.gob.ar

2 Centro de Recursos Naturales Renovables de la Zona Semiarida, CERZOS-CCT-CONICET, Bahía Blanca, Buenos

Aires, Argentina. www.cerzos-conicet.gob.ar

3 Departamento de Matemática, Universidad Nacional del Sur, Bahía Blanca, Buenos Aires, Argentina.

www.matematica.uns.edu.ar

4 Departamento de Agronomía, Universidad Nacional del Sur, Bahía Blanca, Buenos Aires, Argentina.

www.uns.edu.ar/deptos/agronomia

Abstract

Panicum coloratum var. makarikariense, a perennial grass native to Africa, is adapted to a wide range of soil and climatic conditions with potential to be used as forage in tropical and semi-arid regions around the world. Our objective was to

understand how the pollination mode affects viable seed production and further survival of the progeny. We evaluated

self- and open-pollinated progenies from different accessions by measuring the seed production of the parents and their

germination performance, germination rate and seedling survival. Parents and progeny were also fingerprinted with

Simple Sequence Repeats (SSR). Progeny produced through open-pollination resulted in significantly more filled seeds

and superior seedling survival than self-pollination. These results indicate that accessions studied here rely heavily on

cross-pollination, whereas the contribution of self-pollinated offspring to the population is likely to be low. SSR profiles

showed that, on average, 85% of the progeny (arising from cross-pollination) possessed paternal specific markers and

100% of them were genetically different from the maternal genotype. All plants examined had 4x = 36 chromosomes.

Overall, our findings indicate that var. makarikariense is able to generate highly polymorphic progeny through

segregation and recombination. This study provides reference information for the formulation of appropriate strategies

for pasture germplasm management, conservation and development of breeding programs.

Keywords : Breeding systems, pollination, genetic variation, germination, polyploidy, seed production.

Resumen

Panicum coloratum var. makarikariense es una gramínea perenne nativa de África. Se adapta a un amplio rango de ambientes y posee uso potencial como forraje en distintas regiones tropicales y semiáridas del mundo. El estudio tuvo

como objetivo evaluar el efecto del modo de polinización sobre la producción de semilla viable y la supervivencia de la

progenie. Se evaluaron progenies de autopolinización y de polinización cruzada en diferentes accesiones midiendo la

producción de semillas, germinación, tasa de germinación y supervivencia de plántulas, y se obtuvieron perfiles

moleculares con Secuencias Simples Repetidas (SSR). La progenie obtenida mediante polinización cruzada mostró

___________

Correspondence: L. Armando, Instituto Nacional de Tecnología

Agropecuaria, INTA-EEA, 2300 Rafaela, Santa Fe, Argentina.

E-mail: larmando@criba.edu.ar.

Tropical Grasslands-Forrajes Tropicales (ISSN: 2346-3775)

118 L.V. Armando, M.A. Tomás, A.F. Garayalde and A.D. Carrera

significativamente mayor producción de semillas llenas y supervivencia de plántulas que la de autopolinización. Esto

indica que las accesiones evaluadas dependen en gran medida de la alogamia y que la contribución de la descendencia

por autofertilización a la población sería escasa. Los perfiles moleculares SSR mostraron que, en promedio, 85% de la

progenie (obtenida a partir de polinización cruzada) presentó marcadores específicos paternos y 100% de ella difirió del

genotipo materno. Todas las plantas examinadas presentaron 4x = 36 cromosomas. En conjunto, los resultados indican

que la var. makarikariense puede generar progenie altamente polimórfica a través de la segregación y recombinación.

Este estudio provee información útil para el diseño de estrategias de conservación, manejo del germoplasma y programas

de mejoramiento.

Palabras clave : Germinación, polinización, poliploidía, producción de semilla, sistema de reproducción, variación genética.

Introduction

their evolutionary potential. This information is critical

when planning and developing conservation and breeding

The amount of genetic variability within a species and,

programs.

therefore, adaptability of their progeny to the environ-

Panicum coloratum L., a perennial grass native to

ment, are mostly determined by the breeding system.

Africa, is adapted to a wide range of soil and climatic

Autogamous and asexual species produce populations

conditions, and has been used as forage in Australia,

with little evolutionary flexibility and high local

Japan, USA, Mexico and South America (Cook et al.

specialization (Stebbins 1950), whereas outcrossing

2005). This species has been classified into mainly 2

species produce more genetically diverse and ecologically

botanical varieties, var. makarikariense Gooss. and var.

variable offspring. Grasses display an extraordinary

coloratum, distinguished by morphological traits and

diversity of breeding systems including outcrossing,

environmental preferences (Bogdan 1977; Armando et al.

selfing or mixed-breeding, and a mixture of asexual and

2013). The var. makarikariense is particularly well

sexual reproduction (Quinn 1998). Many plant species

adapted to heavy clay soils that fluctuate between drought

have developed different ecological, morphological and

and waterlogged conditions, whereas var. coloratum

physiological mechanisms that reduce the degree of self-

develops well in sandy soils, is tolerant of salinity and

fertilization to promote cross-pollination (Eckert 1994),

performs well at higher latitudes or elevations, as it

most likely motivated by the increase in individual and

thrives under low temperatures, withstanding some frost

(Tischler and Ocumpaugh 2004). In Argentina, a breeding

average population fitness caused by heterosis.

program

and

research

activities involving

var.

The frequency of outcrossing is an important deter-

makarikariense were initiated by the National Institute of

minant of population genetic structure, affecting both

Agricultural Technology (INTA) in 2006, with the

genetic diversity within populations and genetic

purpose of developing new pasture cultivars adapted to

differentiation among them (Barrett and Harder 1996).

marginal (drought, waterlogging, salinity or thermal

Methods commonly employed for assessing the mode of

stress) and less productive environments where livestock

reproduction in forage grasses include cytological and

production has been displaced, with expansion of

embryological analyses of the mother plant and screening

cropping into the most productive paddocks and planting

for morphologically aberrant progeny. Molecular marker

of soybeans.

analysis, in particular, Simple Sequence Repeat (SSR) or

Panicum coloratum botanical varieties have been

microsatellite, is a tool now widely used in a variety of

described as mainly allogamous (Brown and Emery 1958;

fundamental and applied fields of biology, including the

Hutchison and Bashaw 1964), although the degree of self-

identification of selfed, outcrossed or apomictic progeny

fertilization has not been quantified and apomictic

in several grass species (Chistiakov et al. 2006; Liu and

mechanisms have been suggested (Hutchison and Bashaw

Wu 2012). SSRs are loci ubiquitously distributed within

1964). Unlike previous reports, which focused on the

genomes that show a high level of polymorphism,

female parts of flowers and embryo sac development, our

environmental independence and rapid detection pro-

main interest is the analysis of the particular effects of

tocols. The reproductive system and the ploidy level of a

different pollination systems on viable seed production

species determine the transmission of genes across

and the survival of subsequent progeny. In addition,

generations, the pattern of inheritance and gene flow, and

cytogenetic studies in var. makarikariense showed

influence the genetic structure of plant populations and

variable numbers of chromosomes: 2n = 18, 36, 45, 49

Tropical Grasslands-Forrajes Tropicales (ISSN: 2346-3775)

Pollination mode and progeny of Panicum coloratum 119

and 63 (Hutchison and Bashaw 1964; Pritchard and De

sion were placed at 0.6 m intervals in an 8 × 4 matrix plot,

Lacy 1974).

with plots 15 m apart, while the 15 IFF genotypes were

In the present work, progeny of P. coloratum var.

clonally propagated 8 times and arranged linearly in an

makarikariense derived from self- and open-pollinated

8 × 15 matrix plot at a distance of 0.6 m.

panicles were studied through the stages of seed

production, germination and progeny survival. Addi-

Seed production

tional data were obtained from SSR marker analysis,

and chromosome number was also determined. This

Seed production of 3 plants (only 2 plants for accession

study attempted to provide information regarding

DF), selected at random from each of the UCB, MR, BR,

the reproductive behavior of P. coloratum var.

ER and CM accessions and 1 clone of each of the 15 IFF

makarikariense, with utility for conservation and

genotypes (Table 1) (a total of 32 plants) of P. coloratum

breeding.

var. makarikariense, was measured in the field from

March to May 2009. Unfortunately, 1 plant of the DF

Materials and Methods

accession was damaged and data were unavailable. For

each plant, 2 panicles were selected at random: 1 for self-

Plant samples

pollination and 1 for open-pollination. Only a single

panicle was enclosed in each seed trap, the ones for self-

Panicum coloratum was introduced into Argentina in the

pollination before anthesis and the ones for outcrossing

1990s but has not been used widely as forage, although it

when 2/3 of the panicle was in anthesis. Seed traps were

has been conserved at various locations as collections or

used in order to facilitate seed collection and to prevent

in small paddocks. Details of introductions are often

losses by seed shattering. Traps were therefore put in

limited, with many coming from different parts of the

place at different stages of development for self- and

world. A collection of P. coloratum var. makarikariense

open-pollinated treatments, but within the same treat-

(Table 1) was established in a common garden at the

ment attempts were made to select panicles at the same

INTA Rafaela Experiment Station (31°11'41'' S,

stage of development. In self-pollinated treatments seed

61°29'55'' W) in Argentina in 2006, as a breeding popu-

traps were covered with a white cotton bag to prevent

lation. Pre-breeding studies demonstrated a high level of

pollen arrival from other sources without precluding light

variability in morphological and molecular markers, both

interception and photosynthesis of glumes (Figure 1).

among and within accessions, which justified the

Self- and open-pollinated seeds were collected simulta-

initiation of a breeding program (Armando et al. 2013). In

neously once a week and manually separated from the

fact, a cultivar from the program was released recently:

glumes and other residuals. Eventually, the total number

Kapivera INTA (Giordano et al. 2013). The collection

of seeds per inflorescence was counted, i.e. dark brown

comprised 6 accessions of 32 plants each and 15 clonally

seeds (comprising lemma and palea containing a

propagated genotypes (IFF) obtained by selection on

caryopsis). Small light-weight whitish seeds (hereafter

agronomic characteristics. The 32 plants of each acces-

referred to as “empty seeds”) were also produced and

Table 1. Accessions of P. coloratum var. makarikariense and their collection site description.

Accession code

Description

Site of preservation

Coordinates

Province

DF

Twelve-year-old pasture

Dean Funes (150 km Northwest

30°26' S, 64°21' W

Córdoba

Under heavy cattle grazing

from Córdoba city)

UCB

Ungrazed pasture

Catholic University of Córdoba;

31°25' S, 64°11' W

Córdoba

collected in South Africa

MR

Ungrazed pasture

Catholic University of Córdoba;

31°25' S, 64°11' W

Córdoba

collected in South Africa

BR

Ten-year-old pasture under cattle

Mercedes Experiment Station

29°11′ S, 58°02′ W

Corrientes

grazing

(INTA); introduced from Brazil

ER

Five-year-old pasture under cattle

Private farm near Mercedes

29°03' S, 57°49' W

Corrientes

grazing

IFF 1‒15

Clonal materials

CIAP-INTA Institute of Physiology

31°24' S, 61°11' W

Córdoba

and Plant Genetic Resources

CM

Seeds commercially distributed by a cv. ‘Bambatsi’; imported from

-

private company

Australia

Tropical Grasslands-Forrajes Tropicales (ISSN: 2346-3775)

120 L.V. Armando, M.A. Tomás, A.F. Garayalde and A.D. Carrera

counted as immature florets and/or spikelets with pre-

the initiation of the germination trial. Studies by Tomás et

mature shattering from the inflorescences. Empty seeds

al. (2015) showed that maximum germination has been

show poor germination capacity, while dark brown seeds

reached by day 7. A seed was considered germinated

show a high germination percentage (Maina et al. 2017).

when the radicle emerged through the seed coat. Eight-

The final numbers of seeds produced under self- and

day-old seedlings were individually transplanted into 0.5

open-pollinated conditions were compared.

L plastic containers filled with a soil-sand-perlite mix

(1:1:1 v/v), placed in a greenhouse at 28 °C and watered

as needed, usually every 2 to 3 days. Seedling survival

percentage (% Ss) was recorded when seedlings were 15

and 40 days old.

Progeny test

In order to analyze genetic composition of the offspring,

a random sample of 12‒15 seedling descendants from 3

female parents, UCB3, ER1 and IFF10, was genetically

characterized. These plants were selected to represent

the observed range in the number of seeds produced

within var. makarikariense (see Figure 2). Progeny test

was performed only on seeds produced via open

pollination as only a limited number of progeny were

Figure 1. Seed traps enclosing inflorescences consisting of an

obtained from selfing. In addition, progeny obtained from

iron cylindrical structure covered by a nylon stocking (modified

open-pollinated traps resembled more natural pollination

from Young 1986). a) Open-pollination trap (left) and self-

conditions.

pollination trap with a white cloth bag (right). b) Detail of the

DNA extraction was carried out using a modified SDS

lower part of the trap (water drainage). Seeds (= mature florets)

method (Edwards et al. 1991). Approximately 150 mg of

were trapped and funneled into a cap as they shattered from the

leaf tissue (from plants >1 year old) was homogenized in

panicle.

liquid nitrogen. A 700 μL volume of extraction buffer

containing: 50 mM Tris pH 8, 10 mM EDTA pH 8,

Seed germination and seedling survival

100 mM NaCl, 10 mM 𝛽-mercaptoethanol and 10% SDS,

was added and incubated at 65 °C for 20 min. After

Harvested seeds were naturally air-dried and stored at

adding 200 μL of 5 M potassium acetate pH 4.8, the

room temperature in paper bags for 1 year before testing

sample was incubated on ice for at least 20 min and then

for seed germination to ensure dormancy was already

centrifuged at 13,000 rpm for 20 min. This was followed

overcome (Tischler and Young 1987). Of the 32 plants

by precipitation with 700 μL of iso-propanol incubated

evaluated, only 11 produced filled seeds under self-

at -20 °C for 10 min, and centrifugation at 13,000 rpm for

pollination. In each accession, only plants producing a

4 min. The resulting pellet was washed with ethanol 70%

good quantity of filled seeds (UCB3, MR1, BR1, ER1,

and dissolved in 100 μL of 1 x TE buffer. DNA quality

CM2, IFF10; see Figure 2) were used to evaluate

germination and seedling survival (n = 6). Thirty filled

was evaluated in agarose gel and the quantity was

seeds per panicle from the same plants in both self- and

determined by spectrophotometry.

open-pollinated treatments were placed in 10-cm

In previous work, out of 40 heterologous SSR loci

diameter Petri dishes separately with filter paper at the

evaluated in P. coloratum var. makarikariense, 10 primer

bottom moistened with distilled water, and incubated in a

pairs were successfully amplified showing polymorphic

programmed germination chamber at 42% humidity and

and clear banding patterns (Armando et al. 2015). From

27 °C (Tomás et al. 2015) at a 16-hour photoperiod (light

these, the 5 most variable ones were chosen for analysis

photon flux density: 48 mmol/s/m2). Dishes from

both of mother plants and offspring (Table 2).

different pollination treatments and different plants were

Amplification reactions were performed in 20 μL final

randomly arranged in the chamber. The number of

volume containing: 30 ng of DNA template, 2.5 mM

germinated seeds per dish was counted daily and seed

MgCl2, 0.125 mM of each dNTPs, 10 pmol of each primer

germination percentage (% G) was recorded on day 7 after

and 1 U of Taq DNA polymerase in 1.6x buffer. Negative

Tropical Grasslands-Forrajes Tropicales (ISSN: 2346-3775)

Pollination mode and progeny of Panicum coloratum 121

Table 2. Simple sequence repeat (SSR) loci used for progeny analysis and polymerase chain reactions (PCR) conditions.

Repeat motif

Source

Sequence (5´  3´)

TD/Tm

1- (AG)8T(AG)7

EST- Panicum maximum

F: TGTATGAGCTGAGTCGC

63–53/58

R: TGGTAATCTAGTTGATATTC

2- (AG)8